• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Leonurus Japonicus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CCTGTGGAAGGATCATTGTCGAAACCCACAAACCAGACCGCGAACCCATTCCGAACAACCCCGGGGCAGCGGGGGGTGGGCAACCTCCCGTCGTGGCCCCAATCCTGTCACTGCGCGCGCCCGCATCGCGTCGACAAGGCTAACAAACTCGGGCGCAAAATACGTCAAAGAATACACAATATAGCGCTTCCCTCCCTCTCCACGCCCCGTCTGCAAGGCGGTGGGGGAGCCGTGGACATCTAACGAATTTGCAAATGACACTCGGCAACTGATATCTCAACTCTCGCATCGATAAAGAACGTAGAGAAATGCAATACTTGGTGTGAATTGCAGAATCCTGTGAATCATCGAGTTATTGATCACAAGTTGCGCCCAAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCCTTACGCATCGTGTCGCCCCCTCCCCGTGGGGTGTGGTGGAGATTGGCCTCTCCTGCATGCTCGTGCACACAGCCGGCCCAAATGTGAATCCTCCGTCAGTGCGCGTCGCGACCAGTGGTGGTTGATAATTCAACTTGCGTGCTGTCACATCCCGCGTTGTTGTCGTTCAGAAATGACTACGAAACCCAATGGCGTGAGCACACATCGTGCCCACAA

Click for details-----ITS1

CCTGTGGAAGGATCATTGTCGAAACCCACAAACCAGACCGCGAACCCATTCCGAACAACCCCGGGGCAGCGGGGGGTGGGCAACCTCCCGTCGTGGCCCCAATCCTGTCACTGCGCGCGCCCGCATCGCGTCGACAAGGCTAACAAACTCGGGCGCAAAATACGTCAAAGAATACACAATATAGCGCTTCCCTCCCTCTCCACGCCCCGTCTGCAAGGCGGTGGGGGAGCCGTGGACATCTAACGAATTTGCAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO23548
Plant Latin Name: Leonurus Japonicus
Taxonomy Genus: Leonurus
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 4138
Plant-of-the-World-Online: 449195-1

Used in Medicines

Country/Region:
Vietnam; India; Russia; Indonesia

Traditional Medicine System:
Indian Folk; Kampo; TCM


Medicinal Functions:

Alterative; Antibacterial; Antifungal; Aphrodisiac; Birthing aid; Contraceptive; Depurative; Diuretic; Emmenagogue; Hypotensive; Ophthalmic; Poultice; Vasodilator; Vulnerary; Women's complaints

Geographical Distribution

Brazil; Canada; Bangladesh; Nepal; Costa Rica; Cambodia; Bahamas; Peru; Laos; Argentina; Bolivia; Venezuela; Australia; Cuba; El Salvador; Cape Verde; Russia; Suriname; Guatemala; China; Thailand; Haiti; Belize; Philippines; Indonesia; New Caledonia; United States; Trinidad and Tobago; Vietnam; French Guiana; Guyana; Dominican Republic; Jamaica; Honduras; Myanmar; Mexico; South Africa; India; Colombia; Paraguay; Japan; Taiwan; Nicaragua

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

261 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


204 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

136 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99480

Ingredient ID: NPC9880

Ingredient ID: NPC96630

Ingredient ID: NPC96286

Ingredient ID: NPC95675

Ingredient ID: NPC91574

Ingredient ID: NPC89422

Ingredient ID: NPC89069

Ingredient ID: NPC88820

Ingredient ID: NPC88789

Ingredient ID: NPC88759

Ingredient ID: NPC87828

Ingredient ID: NPC8488

Ingredient ID: NPC84226

Ingredient ID: NPC84030

Ingredient ID: NPC79214

Ingredient ID: NPC75840

Ingredient ID: NPC75158

Ingredient ID: NPC7491

Ingredient ID: NPC74539

Ingredient ID: NPC74492

Ingredient ID: NPC7314

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC70744

Ingredient ID: NPC68880

Ingredient ID: NPC67986

Ingredient ID: NPC66577

Ingredient ID: NPC6450

Ingredient ID: NPC64370

Ingredient ID: NPC60556

Ingredient ID: NPC59733

Ingredient ID: NPC59570

Ingredient ID: NPC58478

Ingredient ID: NPC5745

Ingredient ID: NPC55147

Ingredient ID: NPC54407

Ingredient ID: NPC54264

Ingredient ID: NPC52955

Ingredient ID: NPC52230

Ingredient ID: NPC51189

Ingredient ID: NPC50898

Ingredient ID: NPC49074

Ingredient ID: NPC483613

Ingredient ID: NPC483612

Ingredient ID: NPC483611

Ingredient ID: NPC483610

Ingredient ID: NPC483609

Ingredient ID: NPC483608

Ingredient ID: NPC483607

Ingredient ID: NPC483606

Ingredient ID: NPC483605

Ingredient ID: NPC483604

Ingredient ID: NPC483603

Ingredient ID: NPC483602

Ingredient ID: NPC483601

Ingredient ID: NPC483600

Ingredient ID: NPC483599

Ingredient ID: NPC483598

Ingredient ID: NPC483597

Ingredient ID: NPC483596

Ingredient ID: NPC483595

Ingredient ID: NPC483594

Ingredient ID: NPC483593

Ingredient ID: NPC483592

Ingredient ID: NPC483591

Ingredient ID: NPC483590

Ingredient ID: NPC483589

Ingredient ID: NPC483588

Ingredient ID: NPC470620

Ingredient ID: NPC470619

Ingredient ID: NPC470618

Ingredient ID: NPC470617

Ingredient ID: NPC470616

Ingredient ID: NPC46896

Ingredient ID: NPC45270

Ingredient ID: NPC4505

Ingredient ID: NPC44751

Ingredient ID: NPC43696

Ingredient ID: NPC43270

Ingredient ID: NPC43114

Ingredient ID: NPC41144

Ingredient ID: NPC40249

Ingredient ID: NPC39633

Ingredient ID: NPC38751

Ingredient ID: NPC36408

Ingredient ID: NPC34581

Ingredient ID: NPC33605

Ingredient ID: NPC33320

Ingredient ID: NPC331613

Ingredient ID: NPC32931

Ingredient ID: NPC325866

Ingredient ID: NPC32368

Ingredient ID: NPC316232

Ingredient ID: NPC315672

Ingredient ID: NPC3155

Ingredient ID: NPC310099

Ingredient ID: NPC308749

Ingredient ID: NPC308218

Ingredient ID: NPC307963

Ingredient ID: NPC30782

Ingredient ID: NPC306990

Ingredient ID: NPC302327

Ingredient ID: NPC300649

Ingredient ID: NPC297418

Ingredient ID: NPC296266

Ingredient ID: NPC294955

Ingredient ID: NPC294136

Ingredient ID: NPC29081

Ingredient ID: NPC290189

Ingredient ID: NPC290078

Ingredient ID: NPC287928

Ingredient ID: NPC287550

Ingredient ID: NPC287406

Ingredient ID: NPC287374

Ingredient ID: NPC287335

Ingredient ID: NPC286219

Ingredient ID: NPC285494

Ingredient ID: NPC284731

Ingredient ID: NPC284174

Ingredient ID: NPC283655

Ingredient ID: NPC283274

Ingredient ID: NPC282537

Ingredient ID: NPC281131

Ingredient ID: NPC275627

Ingredient ID: NPC274499

Ingredient ID: NPC273385

Ingredient ID: NPC271321

Ingredient ID: NPC26960

Ingredient ID: NPC266539

Ingredient ID: NPC264632

Ingredient ID: NPC263098

Ingredient ID: NPC262524

Ingredient ID: NPC261979

Ingredient ID: NPC260562

Ingredient ID: NPC26045

Ingredient ID: NPC254156

Ingredient ID: NPC254053

Ingredient ID: NPC25002

Ingredient ID: NPC249815

Ingredient ID: NPC249018

Ingredient ID: NPC245768

Ingredient ID: NPC245718

Ingredient ID: NPC244369

Ingredient ID: NPC243577

Ingredient ID: NPC243509

Ingredient ID: NPC242991

Ingredient ID: NPC240899

Ingredient ID: NPC239406

Ingredient ID: NPC238960

Ingredient ID: NPC237084

Ingredient ID: NPC236409

Ingredient ID: NPC236134

Ingredient ID: NPC234536

Ingredient ID: NPC234133

Ingredient ID: NPC23297

Ingredient ID: NPC232841

Ingredient ID: NPC232031

Ingredient ID: NPC231738

Ingredient ID: NPC23145

Ingredient ID: NPC227670

Ingredient ID: NPC227419

Ingredient ID: NPC227378

Ingredient ID: NPC226997

Ingredient ID: NPC223468

Ingredient ID: NPC223388

Ingredient ID: NPC221855

Ingredient ID: NPC220860

Ingredient ID: NPC220763

Ingredient ID: NPC220368

Ingredient ID: NPC218918

Ingredient ID: NPC218109

Ingredient ID: NPC214909

Ingredient ID: NPC214292

Ingredient ID: NPC214067

Ingredient ID: NPC211913

Ingredient ID: NPC210937

Ingredient ID: NPC209275

Ingredient ID: NPC208785

Ingredient ID: NPC20791

Ingredient ID: NPC20742

Ingredient ID: NPC207306

Ingredient ID: NPC206050

Ingredient ID: NPC204100

Ingredient ID: NPC20306

Ingredient ID: NPC201562

Ingredient ID: NPC197584

Ingredient ID: NPC197316

Ingredient ID: NPC196490

Ingredient ID: NPC19240

Ingredient ID: NPC189036

Ingredient ID: NPC187061

Ingredient ID: NPC186996

Ingredient ID: NPC184831

Ingredient ID: NPC184332

Ingredient ID: NPC184049

Ingredient ID: NPC183864

Ingredient ID: NPC182102

Ingredient ID: NPC180684

Ingredient ID: NPC179950

Ingredient ID: NPC179524

Ingredient ID: NPC178887

Ingredient ID: NPC178223

Ingredient ID: NPC177112

Ingredient ID: NPC176740

Ingredient ID: NPC176340

Ingredient ID: NPC176309

Ingredient ID: NPC173996

Ingredient ID: NPC170070

Ingredient ID: NPC169835

Ingredient ID: NPC167385

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC165704

Ingredient ID: NPC162724

Ingredient ID: NPC16157

Ingredient ID: NPC161097

Ingredient ID: NPC158306

Ingredient ID: NPC154477

Ingredient ID: NPC153170

Ingredient ID: NPC152276

Ingredient ID: NPC150329

Ingredient ID: NPC147343

Ingredient ID: NPC14682

Ingredient ID: NPC14576

Ingredient ID: NPC145527

Ingredient ID: NPC143639

Ingredient ID: NPC141777

Ingredient ID: NPC140196

Ingredient ID: NPC14002

Ingredient ID: NPC13991

Ingredient ID: NPC139243

Ingredient ID: NPC138347

Ingredient ID: NPC13789

Ingredient ID: NPC135257

Ingredient ID: NPC135088

Ingredient ID: NPC135077

Ingredient ID: NPC134121

Ingredient ID: NPC132414

Ingredient ID: NPC131981

Ingredient ID: NPC127122

Ingredient ID: NPC126675

Ingredient ID: NPC126240

Ingredient ID: NPC124876

Ingredient ID: NPC121322

Ingredient ID: NPC120926

Ingredient ID: NPC119381

Ingredient ID: NPC118343

Ingredient ID: NPC117493

Ingredient ID: NPC116742

Ingredient ID: NPC114239

Ingredient ID: NPC112746

Ingredient ID: NPC109813

Ingredient ID: NPC109688

Ingredient ID: NPC107015

Ingredient ID: NPC106537

Ingredient ID: NPC106250

Ingredient ID: NPC102503

Ingredient ID: NPC102330

Ingredient ID: NPC101285

Ingredient ID: NPC100445