• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Coriandrum Sativum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AACAGGACAAAAGCCTCGACGCTGCGCAATTGTTACAGTAGCAGTCTTTCTGCTTCTGCAGGTTTCGACCATGATCCCCTCGTGTAGTAGGGGTCTGCGGAAGGATCATTGTCGAAACCTGCAGAAGCAGAACGACCTGCTAACTCGTAAACACATTGGGCAAGCGTCGGGGGGCTTTTGTCCCTTGTTCGCGAATCCCTGGTAGGTGGCCCCTCCTGGGTGGCCGCTGGCCTCAAAATCATTCGGGCGCGGAATGCGCCAAGGAACTTGAAATTGAATTGTACGTCCGCATCCCGTTAGCGGGCAGCGGCGTCATTCCAAAAAACAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATTGTCTTGCCCACAACCACCCACTCCTTGAGGAGTTGTGTTGGTTTGGGGGCGGAAACTGGCCTCCCGTGCCTTGTCGCGCGGTTGGCGGAAAATCGAGTCTCCGACGACGGATGTCGTGACATCGGTGGTTGTAAAAGGCCCTCTTGTCTTGTCACGCGAATCCTAGTCATCTTAGCGAGCTCCAGGACCCTTAGGCGCACACACTCTGTGCGCTTTGA

Click for details-----ITS1

TCTTCTGTAGGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAGAAGCAGAACGACCTGCTAACTCGTAAACACATTGGGCAAGCGTCGGGGGGCTTTTGTCCCTTGTTCGCGAATCCCTGGTAGGTGGCCCCTCCTGGGTGGCCGCTGGCCTCAAAATCATTCGGGCGCGGAATGCGCCAAGGAACTTGAAATTGAATTGTACGTCCGCATCCCGTTAGCGGGCAGCGGCGTCATTCCAAAAAACAA

Click for details-----ITS2

ATTGTCTTGCCCACAACCACCCACTCCTTGAGGAGTTGTGTTGGTTTGGGGGCGGAAACTGGCCTCCCGTGCCTTGTCGCGCGGTTGGCGGAAAATCGAGTCTCCGACGACGGATGTCGTGACATCGGTGGTTGTAAAAGGCCCTCTTGTCTTGTCACGCGAATCCTAGTCATCTTAGCGAGCTCCAGGACCCTTAGGCGCACACACTCTGTGCGCTTTGATTGTGACCCCCAGTCAGGCCGGAATACCCG
Taxonomic Information

Plant ID: NPO2345
Plant Latin Name: Coriandrum Sativum
Taxonomy Genus: Coriandrum
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 4047
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Israel; Italy; Turkmenistan; India; Philippines; Indonesia; Lebanon; China; Jordan; Thailand; South Korea; Iraq; Bulgaria

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM


Medicinal Functions:

Antidiarrhoeal; Antihalitosis; Appetizer; Aromatherapy; Aromatic; Carminative; Depurative; Expectorant; Narcotic; Stimulant; Stomachic

Geographical Distribution

Israel; Italy; Turkmenistan; Lebanon; Philippines; Indonesia; India; China; Thailand; Jordan; South Korea; Iraq; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

142 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


120 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

89 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC99734

Ingredient ID: NPC97192

Ingredient ID: NPC96943

Ingredient ID: NPC95868

Ingredient ID: NPC94167

Ingredient ID: NPC92114

Ingredient ID: NPC92014

Ingredient ID: NPC89069

Ingredient ID: NPC88566

Ingredient ID: NPC85813

Ingredient ID: NPC81010

Ingredient ID: NPC78551

Ingredient ID: NPC76145

Ingredient ID: NPC7568

Ingredient ID: NPC74604

Ingredient ID: NPC70744

Ingredient ID: NPC68548

Ingredient ID: NPC67761

Ingredient ID: NPC62086

Ingredient ID: NPC60151

Ingredient ID: NPC58970

Ingredient ID: NPC55412

Ingredient ID: NPC55254

Ingredient ID: NPC49151

Ingredient ID: NPC490199

Ingredient ID: NPC490198

Ingredient ID: NPC490195

Ingredient ID: NPC490190

Ingredient ID: NPC489923

Ingredient ID: NPC489907

Ingredient ID: NPC48892

Ingredient ID: NPC44751

Ingredient ID: NPC42563

Ingredient ID: NPC424

Ingredient ID: NPC41865

Ingredient ID: NPC37350

Ingredient ID: NPC3649

Ingredient ID: NPC34764

Ingredient ID: NPC34581

Ingredient ID: NPC32977

Ingredient ID: NPC328447

Ingredient ID: NPC326866

Ingredient ID: NPC326143

Ingredient ID: NPC32279

Ingredient ID: NPC322484

Ingredient ID: NPC320738

Ingredient ID: NPC320706

Ingredient ID: NPC320649

Ingredient ID: NPC320180

Ingredient ID: NPC311716

Ingredient ID: NPC30947

Ingredient ID: NPC30005

Ingredient ID: NPC29883

Ingredient ID: NPC296337

Ingredient ID: NPC295644

Ingredient ID: NPC294902

Ingredient ID: NPC292128

Ingredient ID: NPC290319

Ingredient ID: NPC287397

Ingredient ID: NPC279865

Ingredient ID: NPC278068

Ingredient ID: NPC278010

Ingredient ID: NPC277704

Ingredient ID: NPC275462

Ingredient ID: NPC273607

Ingredient ID: NPC269919

Ingredient ID: NPC26906

Ingredient ID: NPC26600

Ingredient ID: NPC2660

Ingredient ID: NPC265305

Ingredient ID: NPC264784

Ingredient ID: NPC262505

Ingredient ID: NPC261991

Ingredient ID: NPC261831

Ingredient ID: NPC259512

Ingredient ID: NPC259134

Ingredient ID: NPC255042

Ingredient ID: NPC254713

Ingredient ID: NPC248743

Ingredient ID: NPC24824

Ingredient ID: NPC246165

Ingredient ID: NPC242580

Ingredient ID: NPC241784

Ingredient ID: NPC239039

Ingredient ID: NPC236579

Ingredient ID: NPC233944

Ingredient ID: NPC232554

Ingredient ID: NPC230301

Ingredient ID: NPC230239

Ingredient ID: NPC225710

Ingredient ID: NPC220171

Ingredient ID: NPC215632

Ingredient ID: NPC213749

Ingredient ID: NPC209037

Ingredient ID: NPC20791

Ingredient ID: NPC20764

Ingredient ID: NPC207077

Ingredient ID: NPC204936

Ingredient ID: NPC203531

Ingredient ID: NPC202415

Ingredient ID: NPC199310

Ingredient ID: NPC190810

Ingredient ID: NPC189436

Ingredient ID: NPC187770

Ingredient ID: NPC187095

Ingredient ID: NPC18205

Ingredient ID: NPC180871

Ingredient ID: NPC179831

Ingredient ID: NPC17810

Ingredient ID: NPC177411

Ingredient ID: NPC177112

Ingredient ID: NPC176951

Ingredient ID: NPC175987

Ingredient ID: NPC173996

Ingredient ID: NPC171280

Ingredient ID: NPC170016

Ingredient ID: NPC168855

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC165651

Ingredient ID: NPC1656

Ingredient ID: NPC164487

Ingredient ID: NPC163556

Ingredient ID: NPC15912

Ingredient ID: NPC156654

Ingredient ID: NPC150950

Ingredient ID: NPC149070

Ingredient ID: NPC147983

Ingredient ID: NPC144023

Ingredient ID: NPC13991

Ingredient ID: NPC138113

Ingredient ID: NPC136014

Ingredient ID: NPC135353

Ingredient ID: NPC131555

Ingredient ID: NPC130683

Ingredient ID: NPC127074

Ingredient ID: NPC113733

Ingredient ID: NPC111888

Ingredient ID: NPC101219