• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Lycium Barbarum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGCGGAAGGATCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACGCGTTTCAACACTGGGGAGCCGCGCGGGCGGGGTGCTTCGGCCCCCCGTGTGCGCGTCTCCCCCCCCTCGTCCCCGGCGCGCGCGCCCGCGCGCGCGTCGGGTGACTAACGAACCCCGGCGCGAAAAGCGCCAAGGAATACTTAAATTGATAGCCTGCCTCTCGCGCCCCGTCCGCGGTGCGCGCGGGAGGGCCTGTGCTTCTCTTGAAACAGAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCGCGCACCGCGCCCATGCTCTGGGTCGCGGTGGTGTCGCGGGGCGGATACTGGCCTCCCGTGCGCCTCGCGCTCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGTAACCCAACTCTCGAAGTGTCGTGGCCATACCCCGTCGCGCGTTTGGCCTCCCGGACCCTTCTCGCGCTTAGGCGCTCCGACCGCGACC

Click for details-----ITS1

CTGCGGAAGGATCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACGCGTTTCAACACTGGGGAGCCGGGGGGGGCGGGGGGGCTTCGGCCCCCCGTGGTGCGGGTCTTCCCCCCCCTGTCCCGGCGCGCGCGCCCGCGCGCGCGTCGGGTGACTAACGAACCCCGGCGCGAAAAGCGCCAAGGAATACTTAAATTGATAGCCTGCCTCTCGCGCCCCGTCCGCGGTGCGCGCGGGAGGGCCTGTGCTTCTCTTGAAACAGAAA

Click for details-----ITS2

ATCGTGTTGCCCCCGCCCACCGCACCCACGCTCTGGGTCGCGGTGGTGTCGCGGGGCAGATACTCGCCTCCCGTGAGCCTCGCGCTCGCGGCTGGCCTAAATACGAGTCCACGTCGACAGACGTCACGGCAAGTGGTGGTTGTAACCCAACTCTCGAAGTGTCGTGGCTATACCCCGTCGCGCGTTTGGCCTCCCGGACCCTTCTCGCGCTTAGGCGCTCCGACC
Taxonomic Information

Plant ID: NPO23429
Plant Latin Name: Lycium Barbarum
Taxonomy Genus: Lycium
Taxonomy Family: Solanaceae

Plant External Links:

NCBI TaxonomyDB: 112863
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; South Korea; India

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Antibacterial; Anticholesterolemic; Antipyretic; Cancer; Diuretic; Hypoglycaemic; Ophthalmic; Purgative; Skin; Tonic; Vasodilator

Geographical Distribution

India; South Korea; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

212 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


158 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

132 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98307

Ingredient ID: NPC96294

Ingredient ID: NPC95952

Ingredient ID: NPC95539

Ingredient ID: NPC93081

Ingredient ID: NPC93077

Ingredient ID: NPC92592

Ingredient ID: NPC91081

Ingredient ID: NPC87564

Ingredient ID: NPC85813

Ingredient ID: NPC84281

Ingredient ID: NPC83295

Ingredient ID: NPC82648

Ingredient ID: NPC82460

Ingredient ID: NPC82164

Ingredient ID: NPC81010

Ingredient ID: NPC78500

Ingredient ID: NPC77448

Ingredient ID: NPC77446

Ingredient ID: NPC76336

Ingredient ID: NPC76145

Ingredient ID: NPC72697

Ingredient ID: NPC70744

Ingredient ID: NPC68873

Ingredient ID: NPC68271

Ingredient ID: NPC66681

Ingredient ID: NPC66303

Ingredient ID: NPC64370

Ingredient ID: NPC64022

Ingredient ID: NPC60942

Ingredient ID: NPC60548

Ingredient ID: NPC59650

Ingredient ID: NPC59581

Ingredient ID: NPC56505

Ingredient ID: NPC55681

Ingredient ID: NPC55484

Ingredient ID: NPC5326

Ingredient ID: NPC52955

Ingredient ID: NPC52403

Ingredient ID: NPC52029

Ingredient ID: NPC50898

Ingredient ID: NPC49151

Ingredient ID: NPC48747

Ingredient ID: NPC483744

Ingredient ID: NPC483743

Ingredient ID: NPC483742

Ingredient ID: NPC483741

Ingredient ID: NPC483740

Ingredient ID: NPC483739

Ingredient ID: NPC483738

Ingredient ID: NPC483737

Ingredient ID: NPC483736

Ingredient ID: NPC483735

Ingredient ID: NPC483734

Ingredient ID: NPC483733

Ingredient ID: NPC483732

Ingredient ID: NPC468994

Ingredient ID: NPC46801

Ingredient ID: NPC46780

Ingredient ID: NPC46248

Ingredient ID: NPC45782

Ingredient ID: NPC45614

Ingredient ID: NPC42471

Ingredient ID: NPC41473

Ingredient ID: NPC40170

Ingredient ID: NPC3857

Ingredient ID: NPC34764

Ingredient ID: NPC34589

Ingredient ID: NPC32977

Ingredient ID: NPC329148

Ingredient ID: NPC327013

Ingredient ID: NPC325439

Ingredient ID: NPC325025

Ingredient ID: NPC32279

Ingredient ID: NPC320607

Ingredient ID: NPC317609

Ingredient ID: NPC313179

Ingredient ID: NPC313059

Ingredient ID: NPC312770

Ingredient ID: NPC310648

Ingredient ID: NPC307732

Ingredient ID: NPC306397

Ingredient ID: NPC30433

Ingredient ID: NPC302857

Ingredient ID: NPC302327

Ingredient ID: NPC301585

Ingredient ID: NPC300059

Ingredient ID: NPC299545

Ingredient ID: NPC299515

Ingredient ID: NPC294902

Ingredient ID: NPC294815

Ingredient ID: NPC294548

Ingredient ID: NPC291886

Ingredient ID: NPC291517

Ingredient ID: NPC291305

Ingredient ID: NPC291066

Ingredient ID: NPC291027

Ingredient ID: NPC290613

Ingredient ID: NPC290442

Ingredient ID: NPC290319

Ingredient ID: NPC29

Ingredient ID: NPC289974

Ingredient ID: NPC289758

Ingredient ID: NPC28815

Ingredient ID: NPC286233

Ingredient ID: NPC285343

Ingredient ID: NPC283790

Ingredient ID: NPC283148

Ingredient ID: NPC282909

Ingredient ID: NPC282102

Ingredient ID: NPC281457

Ingredient ID: NPC280135

Ingredient ID: NPC279895

Ingredient ID: NPC279300

Ingredient ID: NPC2785

Ingredient ID: NPC278430

Ingredient ID: NPC278310

Ingredient ID: NPC277156

Ingredient ID: NPC275462

Ingredient ID: NPC273390

Ingredient ID: NPC273385

Ingredient ID: NPC270637

Ingredient ID: NPC270334

Ingredient ID: NPC268572

Ingredient ID: NPC268221

Ingredient ID: NPC266539

Ingredient ID: NPC265885

Ingredient ID: NPC259330

Ingredient ID: NPC256186

Ingredient ID: NPC255452

Ingredient ID: NPC251788

Ingredient ID: NPC250539

Ingredient ID: NPC249801

Ingredient ID: NPC24967

Ingredient ID: NPC243728

Ingredient ID: NPC24101

Ingredient ID: NPC236119

Ingredient ID: NPC234005

Ingredient ID: NPC233231

Ingredient ID: NPC232189

Ingredient ID: NPC231772

Ingredient ID: NPC230301

Ingredient ID: NPC23004

Ingredient ID: NPC226087

Ingredient ID: NPC223697

Ingredient ID: NPC222997

Ingredient ID: NPC222084

Ingredient ID: NPC22140

Ingredient ID: NPC217226

Ingredient ID: NPC217218

Ingredient ID: NPC216630

Ingredient ID: NPC216330

Ingredient ID: NPC211913

Ingredient ID: NPC211401

Ingredient ID: NPC209970

Ingredient ID: NPC209773

Ingredient ID: NPC209111

Ingredient ID: NPC205491

Ingredient ID: NPC203142

Ingredient ID: NPC203064

Ingredient ID: NPC197977

Ingredient ID: NPC195749

Ingredient ID: NPC195064

Ingredient ID: NPC194944

Ingredient ID: NPC193989

Ingredient ID: NPC190810

Ingredient ID: NPC185839

Ingredient ID: NPC18188

Ingredient ID: NPC181465

Ingredient ID: NPC1813

Ingredient ID: NPC179831

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC176521

Ingredient ID: NPC173582

Ingredient ID: NPC171148

Ingredient ID: NPC169786

Ingredient ID: NPC169485

Ingredient ID: NPC167976

Ingredient ID: NPC167545

Ingredient ID: NPC164487

Ingredient ID: NPC163556

Ingredient ID: NPC162034

Ingredient ID: NPC161555

Ingredient ID: NPC16087

Ingredient ID: NPC158876

Ingredient ID: NPC158565

Ingredient ID: NPC154515

Ingredient ID: NPC152451

Ingredient ID: NPC151157

Ingredient ID: NPC149184

Ingredient ID: NPC148951

Ingredient ID: NPC148835

Ingredient ID: NPC14600

Ingredient ID: NPC142319

Ingredient ID: NPC140872

Ingredient ID: NPC140389

Ingredient ID: NPC139548

Ingredient ID: NPC139416

Ingredient ID: NPC136996

Ingredient ID: NPC131969

Ingredient ID: NPC125144

Ingredient ID: NPC122962

Ingredient ID: NPC122009

Ingredient ID: NPC113837

Ingredient ID: NPC111888

Ingredient ID: NPC10781

Ingredient ID: NPC1075

Ingredient ID: NPC107482

Ingredient ID: NPC103612

Ingredient ID: NPC102449

Ingredient ID: NPC100276