• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Taraxacum Coreanum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAGGCAGAACGACCCGTGAACACGTAAATACAACCGGGTGATGGGGAGATGGATCTTGGTTTTGATCCTCAACACCTTCCAGCGTGCCTGCATGATTTCTCTTTTGGCTATCATGCTTGTATTGTTGGACTTTAACCAAACCCCGGCACGGCATGTGCCAAGGAAAACAATAAACGAGAAGGACTCGACCTGTTATGCCCCGTTTGTGGTGTGCATTCTGAGCGTGTCCTCCTTTTATTCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGTTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCGTCATAGTTCCCTTAAGGGTAGTCGTGGTGATTGGGAGCGGAAATTGGCCTCCCGTGCTTGTTGTGCGGTTGGTCAAAATACGAGTCCCCTTCGGTGGACACACGGCTAGTGGTGGTTGTAAAGACCCTTTTCTTCTGCTGTGTGTCGTGAGCTGCTAGGGAAGCCCTCAAAAAAGACCCCATTGTATCGTCTTAGATGATGCTTCGA

Click for details-----ITS1

GTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAGGCAGAACGACCCGTGAACACGTAAATACAACCGGGTGATGGGGAGATGGATCTTGGTTTTGATCCTCAACACCTTCCAGCGTGCCTGCATGATTTCTCTTTTGGCTATCATGCTTGTATTGTTGGACTTTAACCAAACCCCGGCACGGCATGTGCCAAGGAAAACAATAAACGAGAAGGACTCGACCTGTTATGCCCCGTTTGTGGTGTGCATTCTGAGCGTGTCCTCCTTTTATTCACAAA

Click for details-----ITS2

ATCGCGTCGCTCCCGTCATAGTTCCCTTAAGGGTAGTCGTGGTGATTGGGAGCGGAAATTGACCTCCCGTGCTTGTTGTGCGGTTGGTCAAAATACGAGTCCCCTTCGGTGGACACACGGCTAGTGGTGGTTGTAAAGACCCTTTTCTTCTGCTGTGTGTCGTGAGCTGCTAGGGAAGCCCTCAAAAAAGACCCCATTGTATCGTCTTAGGATGATGCTTCGACCGCGACCCCAGGTCAGGCGGGA
Taxonomic Information

Plant ID: NPO23327
Plant Latin Name: Taraxacum Coreanum
Taxonomy Genus: Taraxacum
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 1041103
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

135 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


68 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

83 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98543

Ingredient ID: NPC96403

Ingredient ID: NPC96218

Ingredient ID: NPC95381

Ingredient ID: NPC92774

Ingredient ID: NPC88789

Ingredient ID: NPC85813

Ingredient ID: NPC85550

Ingredient ID: NPC81775

Ingredient ID: NPC81010

Ingredient ID: NPC79056

Ingredient ID: NPC7208

Ingredient ID: NPC71296

Ingredient ID: NPC70756

Ingredient ID: NPC70744

Ingredient ID: NPC70388

Ingredient ID: NPC64349

Ingredient ID: NPC5326

Ingredient ID: NPC44328

Ingredient ID: NPC39793

Ingredient ID: NPC38751

Ingredient ID: NPC3357

Ingredient ID: NPC32977

Ingredient ID: NPC32626

Ingredient ID: NPC32589

Ingredient ID: NPC32021

Ingredient ID: NPC306990

Ingredient ID: NPC30374

Ingredient ID: NPC302950

Ingredient ID: NPC302857

Ingredient ID: NPC302003

Ingredient ID: NPC29884

Ingredient ID: NPC29883

Ingredient ID: NPC295832

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC289774

Ingredient ID: NPC289758

Ingredient ID: NPC285364

Ingredient ID: NPC281131

Ingredient ID: NPC279121

Ingredient ID: NPC278102

Ingredient ID: NPC278068

Ingredient ID: NPC27359

Ingredient ID: NPC272614

Ingredient ID: NPC26960

Ingredient ID: NPC268221

Ingredient ID: NPC252558

Ingredient ID: NPC251407

Ingredient ID: NPC245947

Ingredient ID: NPC245561

Ingredient ID: NPC245346

Ingredient ID: NPC242580

Ingredient ID: NPC24146

Ingredient ID: NPC237506

Ingredient ID: NPC234133

Ingredient ID: NPC230301

Ingredient ID: NPC225710

Ingredient ID: NPC224389

Ingredient ID: NPC223697

Ingredient ID: NPC22033

Ingredient ID: NPC217052

Ingredient ID: NPC216630

Ingredient ID: NPC214134

Ingredient ID: NPC213935

Ingredient ID: NPC21290

Ingredient ID: NPC210040

Ingredient ID: NPC209970

Ingredient ID: NPC20791

Ingredient ID: NPC20742

Ingredient ID: NPC207339

Ingredient ID: NPC206095

Ingredient ID: NPC203719

Ingredient ID: NPC20286

Ingredient ID: NPC202642

Ingredient ID: NPC200502

Ingredient ID: NPC198398

Ingredient ID: NPC197376

Ingredient ID: NPC196924

Ingredient ID: NPC194562

Ingredient ID: NPC192638

Ingredient ID: NPC192402

Ingredient ID: NPC192400

Ingredient ID: NPC191608

Ingredient ID: NPC191306

Ingredient ID: NPC19047

Ingredient ID: NPC19045

Ingredient ID: NPC189142

Ingredient ID: NPC182102

Ingredient ID: NPC181455

Ingredient ID: NPC179950

Ingredient ID: NPC176740

Ingredient ID: NPC176300

Ingredient ID: NPC175378

Ingredient ID: NPC171736

Ingredient ID: NPC17007

Ingredient ID: NPC169749

Ingredient ID: NPC167976

Ingredient ID: NPC16728

Ingredient ID: NPC165967

Ingredient ID: NPC162797

Ingredient ID: NPC156655

Ingredient ID: NPC156654

Ingredient ID: NPC156353

Ingredient ID: NPC153958

Ingredient ID: NPC15336

Ingredient ID: NPC151251

Ingredient ID: NPC145038

Ingredient ID: NPC143586

Ingredient ID: NPC137949

Ingredient ID: NPC137702

Ingredient ID: NPC135088

Ingredient ID: NPC133852

Ingredient ID: NPC132446

Ingredient ID: NPC132307

Ingredient ID: NPC131174

Ingredient ID: NPC130683

Ingredient ID: NPC126925

Ingredient ID: NPC126759

Ingredient ID: NPC117493

Ingredient ID: NPC116709

Ingredient ID: NPC115979

Ingredient ID: NPC11433

Ingredient ID: NPC113733

Ingredient ID: NPC113212

Ingredient ID: NPC113101

Ingredient ID: NPC112454

Ingredient ID: NPC110899

Ingredient ID: NPC110377

Ingredient ID: NPC10781

Ingredient ID: NPC1075

Ingredient ID: NPC104216

Ingredient ID: NPC103890