• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Polygala Glomerata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAAACCTACTCGAAAGAGCGATCGTTGGACACGTATACCATCACGGTGGGCGGATGGGTGCATGCGCTGCACCCATCCACCCCCTCGTGTCGGGCGTGGATGATGGGGTGGTGCTGGCCTCGCTACGGCATTGGCTCCCTCCCCTCCGTCCTCGACCGGTGCAAACAACTAAAACTCCAGCGCAAGAAGCGCCAAGGAAGTCGTACCGACCGCGCGCGCCCACTTTGGCCCTGGAGACGGTGTGCCTGCCGGGCGCGTGCCGGACAATATTGTCGTGAAAACTTAA

Click for details-----ITS2

ATCGTCGCCCCTCTTCCTCATCGCCTCGTCCGCTGGGCGAGGAGCTGGGGGGTGGCGGATGGTGGTCTCCTGTGTGCCTTGGCATGCGGCTGGCTGAAAATTGCAGGACCACGGTGCCGAACGCCGCGTCGCATGGTGGATGAGATAATCTCCAAGACAGGACGTGTGCGCCGCCGTTTCCCGGATTGGACCCAATGCGCTGCGTTGCAGTGCCCTCCG
Taxonomic Information

Plant ID: NPO23251
Plant Latin Name: Polygala Glomerata
Taxonomy Genus: Polygala
Taxonomy Family: Polygalaceae

Plant External Links:

NCBI TaxonomyDB: 1571643
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; India

Traditional Medicine System:
Indian Folk

Geographical Distribution

Thailand; India

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

12 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


9 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC86412

Ingredient ID: NPC85813

Ingredient ID: NPC69626

Ingredient ID: NPC301323

Ingredient ID: NPC271805

Ingredient ID: NPC261831

Ingredient ID: NPC250822

Ingredient ID: NPC216630

Ingredient ID: NPC196439

Ingredient ID: NPC176775

Ingredient ID: NPC156903

Ingredient ID: NPC133594