• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Allium Cepa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGAAGGATCATTGTAGAGTTCCTTCTCGAACAACTGTGAAATTGTACTCATACCCGTCGAGAACTACGTATTTGTGCGGTTAGCACTTGCGTTGTTTGGATGGGTTTCATTTGCTGCCTTCATGTTTGCTTCAATTGAAGTAAGATGTAGAGTAGAACTAAGAAACCGGCACGGTTTGTGCCAAGGACAGTTGTTGTTGGAGAGCTTGCCATCATTTTGATGTGCTTCGTGTTATTCCAGTGAGCGTCTGAATGACTCCTGGCAATGGATATCTTGGCTCTCGTGTCGATGAAGAACGTAGCGAAATGCGACACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCTCGAGGCCATTAGGTTGAGAGCACGTCTGTTTGGGCGTCATGCANAGCGTCATTCCAATCTCCCTCATGCGACGAGTGCATTTTGGGTTATGATGGATATGGAGAATGACCTTCCGTGCTTTAATTGTATGGTAGGTTTAAGTGATTGTCGTTGCCAGTTATATGCGAGGCGAATGGTGTGTCGAGTTAACGCACGATGTCTCTAATCGCGTCCATGAGACCTAGGCATGACTTAGCACTAGCTAAAACCGATTTCGATGTTTGCTTTTGTAGCAGGCTCGGACCATGACCTCAGATC

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO23230
Plant Latin Name: Allium Cepa
Taxonomy Genus: Allium
Taxonomy Family: Amaryllidaceae

Plant External Links:

NCBI TaxonomyDB: 4679
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Brazil; Turkey; Italy; Turkmenistan; India; Argentina; Nigeria; Israel; Burkina Faso; Germany; Chile; Kuwait; Jordan; Spain; Philippines; Indonesia; Saudi Arabia; United States; Vietnam; Thailand; Yemen; Portugal; Mexico; Tunisia; South Africa; Lebanon; Malaysia; China; Greece; Guinea

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Anthelmintic; Antiinflammatory; Antiseptic; Antispasmodic; Appetizer; Carminative; Diuretic; Expectorant; Febrifuge; Homeopathy; Hypoglycaemic; Hypotensive; Lithontripic; Skin; Stings; Stomachic; Tonic

Geographical Distribution

Brazil; Turkey; Italy; Turkmenistan; Guinea; Argentina; Burkina Faso; Israel; Jordan; Chile; Kuwait; Germany; Spain; Nigeria; Philippines; Indonesia; Saudi Arabia; United States; Vietnam; Thailand; Yemen; Portugal; Mexico; Tunisia; South Africa; India; Malaysia; China; Greece; Lebanon

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

169 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


122 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

93 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC96582

Ingredient ID: NPC94610

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC92966

Ingredient ID: NPC88603

Ingredient ID: NPC86655

Ingredient ID: NPC84127

Ingredient ID: NPC82920

Ingredient ID: NPC82287

Ingredient ID: NPC81015

Ingredient ID: NPC78312

Ingredient ID: NPC77916

Ingredient ID: NPC74826

Ingredient ID: NPC74543

Ingredient ID: NPC70744

Ingredient ID: NPC69445

Ingredient ID: NPC62765

Ingredient ID: NPC62045

Ingredient ID: NPC60735

Ingredient ID: NPC59581

Ingredient ID: NPC57020

Ingredient ID: NPC55893

Ingredient ID: NPC5447

Ingredient ID: NPC50898

Ingredient ID: NPC49871

Ingredient ID: NPC490447

Ingredient ID: NPC490439

Ingredient ID: NPC490424

Ingredient ID: NPC490395

Ingredient ID: NPC490332

Ingredient ID: NPC490255

Ingredient ID: NPC490201

Ingredient ID: NPC490120

Ingredient ID: NPC490119

Ingredient ID: NPC490118

Ingredient ID: NPC490117

Ingredient ID: NPC490069

Ingredient ID: NPC490000

Ingredient ID: NPC479874

Ingredient ID: NPC44263

Ingredient ID: NPC42471

Ingredient ID: NPC42403

Ingredient ID: NPC42150

Ingredient ID: NPC4154

Ingredient ID: NPC38508

Ingredient ID: NPC38249

Ingredient ID: NPC3780

Ingredient ID: NPC37793

Ingredient ID: NPC3423

Ingredient ID: NPC328447

Ingredient ID: NPC326391

Ingredient ID: NPC322254

Ingredient ID: NPC319387

Ingredient ID: NPC317120

Ingredient ID: NPC309330

Ingredient ID: NPC302632

Ingredient ID: NPC300326

Ingredient ID: NPC300059

Ingredient ID: NPC299704

Ingredient ID: NPC299134

Ingredient ID: NPC29911

Ingredient ID: NPC29883

Ingredient ID: NPC298448

Ingredient ID: NPC297990

Ingredient ID: NPC297753

Ingredient ID: NPC296912

Ingredient ID: NPC294902

Ingredient ID: NPC293804

Ingredient ID: NPC293628

Ingredient ID: NPC291473

Ingredient ID: NPC291049

Ingredient ID: NPC288588

Ingredient ID: NPC285197

Ingredient ID: NPC281686

Ingredient ID: NPC279661

Ingredient ID: NPC279121

Ingredient ID: NPC27836

Ingredient ID: NPC273483

Ingredient ID: NPC272614

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC269442

Ingredient ID: NPC265305

Ingredient ID: NPC264395

Ingredient ID: NPC26230

Ingredient ID: NPC261831

Ingredient ID: NPC260837

Ingredient ID: NPC257090

Ingredient ID: NPC255467

Ingredient ID: NPC254764

Ingredient ID: NPC252929

Ingredient ID: NPC249310

Ingredient ID: NPC246679

Ingredient ID: NPC245346

Ingredient ID: NPC242580

Ingredient ID: NPC237812

Ingredient ID: NPC233267

Ingredient ID: NPC230349

Ingredient ID: NPC230085

Ingredient ID: NPC229477

Ingredient ID: NPC22908

Ingredient ID: NPC226453

Ingredient ID: NPC225710

Ingredient ID: NPC225434

Ingredient ID: NPC221178

Ingredient ID: NPC21100

Ingredient ID: NPC210587

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC206988

Ingredient ID: NPC204364

Ingredient ID: NPC203468

Ingredient ID: NPC197087

Ingredient ID: NPC196434

Ingredient ID: NPC196333

Ingredient ID: NPC194465

Ingredient ID: NPC193989

Ingredient ID: NPC191534

Ingredient ID: NPC191235

Ingredient ID: NPC190454

Ingredient ID: NPC188920

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC184203

Ingredient ID: NPC181350

Ingredient ID: NPC179950

Ingredient ID: NPC17817

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC176510

Ingredient ID: NPC175575

Ingredient ID: NPC174477

Ingredient ID: NPC174406

Ingredient ID: NPC174246

Ingredient ID: NPC172904

Ingredient ID: NPC171754

Ingredient ID: NPC169749

Ingredient ID: NPC167400

Ingredient ID: NPC161593

Ingredient ID: NPC159854

Ingredient ID: NPC158069

Ingredient ID: NPC156654

Ingredient ID: NPC156461

Ingredient ID: NPC156018

Ingredient ID: NPC152451

Ingredient ID: NPC1502

Ingredient ID: NPC146422

Ingredient ID: NPC141645

Ingredient ID: NPC139381

Ingredient ID: NPC137739

Ingredient ID: NPC136281

Ingredient ID: NPC136014

Ingredient ID: NPC135539

Ingredient ID: NPC133183

Ingredient ID: NPC126681

Ingredient ID: NPC125062

Ingredient ID: NPC119952

Ingredient ID: NPC119090

Ingredient ID: NPC118429

Ingredient ID: NPC116775

Ingredient ID: NPC115358

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC111888

Ingredient ID: NPC109494

Ingredient ID: NPC109034

Ingredient ID: NPC108645