• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Plantago Lundborgii


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCTAAAAAGTAGACCAGCGAACACGTGTTTAACATGAACGGTGCCTCGGTGGGACGGAGTCATATCTGCCCCAGCGGGTCGCCGTGCCTTCCCGGTGCTCGCACCTCGAGGGCTAACGAACCCCGGCGCGGCCAGCGCCAAGGAAAACAAAAACAGAATCGTTGCCCCTACGGCCCCCGTCCGCGGAGTGGTTGTGGGGATGCAGCGTATCTTGAAAGTCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAGCCCCTCGTGGACTGGTGATGGGGCGGAAAATGGCTTCCCGTTGTCTCGGCTAGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAGATCATTGGTGCCGTTGTGCTTCACCCTGTCGCTTGGTAGGGCATCGTCATAAACCAACGGCGCGTAATGCGCCTTCGA

Click for details-----ITS1

TCGAATCTAAAAAGTAGACCAGCGAACACGTGTTTAACATGAACGGTGCCTCGGTGGGACGGAGTCATATCTGCCCCAGCGGGTCGCCGTGCCTTCCCGGTGCTCGCACCTCGAGGGCTAACGAACCCCGGCGCGGCCAGCGCCAAGGAAAACAAAAACAGAATCGTTGCCCCTACGGCCCCCGTCCGCGGAGTGGTTGTGGGGATGCAGCGTATCTTGAAAGTCATAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO2323
Plant Latin Name: Plantago Lundborgii
Taxonomy Genus: Plantago
Taxonomy Family: Plantaginaceae

Plant External Links:

NCBI TaxonomyDB: 197807
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

143 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


110 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

22 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98272

Ingredient ID: NPC98041

Ingredient ID: NPC96700

Ingredient ID: NPC95952

Ingredient ID: NPC89010

Ingredient ID: NPC86177

Ingredient ID: NPC8180

Ingredient ID: NPC81198

Ingredient ID: NPC80131

Ingredient ID: NPC76513

Ingredient ID: NPC76306

Ingredient ID: NPC74898

Ingredient ID: NPC73804

Ingredient ID: NPC73497

Ingredient ID: NPC69750

Ingredient ID: NPC69386

Ingredient ID: NPC68889

Ingredient ID: NPC68153

Ingredient ID: NPC65182

Ingredient ID: NPC64568

Ingredient ID: NPC59217

Ingredient ID: NPC58082

Ingredient ID: NPC57615

Ingredient ID: NPC54597

Ingredient ID: NPC53820

Ingredient ID: NPC48175

Ingredient ID: NPC45271

Ingredient ID: NPC43920

Ingredient ID: NPC39654

Ingredient ID: NPC394

Ingredient ID: NPC34247

Ingredient ID: NPC34220

Ingredient ID: NPC32806

Ingredient ID: NPC311626

Ingredient ID: NPC310513

Ingredient ID: NPC309932

Ingredient ID: NPC309799

Ingredient ID: NPC309225

Ingredient ID: NPC302857

Ingredient ID: NPC30013

Ingredient ID: NPC297643

Ingredient ID: NPC296024

Ingredient ID: NPC295390

Ingredient ID: NPC295148

Ingredient ID: NPC294902

Ingredient ID: NPC294225

Ingredient ID: NPC286005

Ingredient ID: NPC285399

Ingredient ID: NPC284827

Ingredient ID: NPC283521

Ingredient ID: NPC282804

Ingredient ID: NPC281270

Ingredient ID: NPC278804

Ingredient ID: NPC277718

Ingredient ID: NPC274739

Ingredient ID: NPC271489

Ingredient ID: NPC271138

Ingredient ID: NPC267612

Ingredient ID: NPC266841

Ingredient ID: NPC263774

Ingredient ID: NPC25253

Ingredient ID: NPC251418

Ingredient ID: NPC249168

Ingredient ID: NPC247359

Ingredient ID: NPC245130

Ingredient ID: NPC244776

Ingredient ID: NPC24327

Ingredient ID: NPC241573

Ingredient ID: NPC241442

Ingredient ID: NPC238950

Ingredient ID: NPC238193

Ingredient ID: NPC23146

Ingredient ID: NPC231336

Ingredient ID: NPC229785

Ingredient ID: NPC228227

Ingredient ID: NPC225773

Ingredient ID: NPC225205

Ingredient ID: NPC224389

Ingredient ID: NPC222001

Ingredient ID: NPC213650

Ingredient ID: NPC213056

Ingredient ID: NPC20985

Ingredient ID: NPC208698

Ingredient ID: NPC208281

Ingredient ID: NPC20791

Ingredient ID: NPC207627

Ingredient ID: NPC206902

Ingredient ID: NPC206876

Ingredient ID: NPC206231

Ingredient ID: NPC200412

Ingredient ID: NPC198672

Ingredient ID: NPC197356

Ingredient ID: NPC196107

Ingredient ID: NPC195435

Ingredient ID: NPC195057

Ingredient ID: NPC195055

Ingredient ID: NPC193942

Ingredient ID: NPC192831

Ingredient ID: NPC192266

Ingredient ID: NPC191409

Ingredient ID: NPC189238

Ingredient ID: NPC188661

Ingredient ID: NPC186896

Ingredient ID: NPC186320

Ingredient ID: NPC185312

Ingredient ID: NPC182497

Ingredient ID: NPC182258

Ingredient ID: NPC179950

Ingredient ID: NPC17985

Ingredient ID: NPC179505

Ingredient ID: NPC176740

Ingredient ID: NPC176605

Ingredient ID: NPC176365

Ingredient ID: NPC170404

Ingredient ID: NPC169529

Ingredient ID: NPC168295

Ingredient ID: NPC16620

Ingredient ID: NPC164008

Ingredient ID: NPC159728

Ingredient ID: NPC158334

Ingredient ID: NPC154715

Ingredient ID: NPC150628

Ingredient ID: NPC147969

Ingredient ID: NPC147796

Ingredient ID: NPC145525

Ingredient ID: NPC14121

Ingredient ID: NPC139717

Ingredient ID: NPC13818

Ingredient ID: NPC136167

Ingredient ID: NPC135468

Ingredient ID: NPC130249

Ingredient ID: NPC130210

Ingredient ID: NPC128940

Ingredient ID: NPC125832

Ingredient ID: NPC123881

Ingredient ID: NPC123836

Ingredient ID: NPC121759

Ingredient ID: NPC113389

Ingredient ID: NPC109813

Ingredient ID: NPC108405

Ingredient ID: NPC105542

Ingredient ID: NPC103777

Ingredient ID: NPC10078