CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Symphytum Officinale

Example Image

PLANiTS DNA barcode

ATCTCGTCACCGCATCCCTAATNTTTTGTGTATCGGTGGAATGTGACCTCCTGCTCCTAGTTGTGCAGTTGGTTAAAACTTGAGTATGTGGATTAGGACTTCACGACAAGTGGTGGTTGGATAACAACTCTCGTCATGTCGTGTGCCAAGCCCACGTTACTTTCAAGACCCTATGGTGCAAGTTACCCTCATTTGTTTTGTTGGAAACATGTTCTATG

Taxonomic Information

Plant ID: NPO23223
Plant Latin Name: Symphytum Officinale
Taxonomy Genus: Symphytum
Taxonomy Family: Boraginaceae

Plant External Links:

NCBI TaxonomyDB: 278672
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

Madagascar; Finland; Angola; South Africa; India; Indonesia; Lithuania; Zimbabwe; China; Swaziland; Spain

Traditional Medicine System:

TCM

Medicinal Functions:

Anodyne; Antidiarrhoeal; Antirheumatic; Astringent; Demulcent; Emollient; Expectorant; Haemostatic; Homeopathy; Refrigerant; Vulnerary

Geographical Distribution

Madagascar; Indonesia; Angola; South Africa; India; Finland; Lithuania; Zimbabwe; China; Swaziland; Spain

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

35 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

31 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

18 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC90549

Ingredient ID: NPC85758

Ingredient ID: NPC77572

Ingredient ID: NPC67978

Ingredient ID: NPC61

Ingredient ID: NPC54379

Ingredient ID: NPC53069

Ingredient ID: NPC48053

Ingredient ID: NPC46744

Ingredient ID: NPC46451

Ingredient ID: NPC42494

Ingredient ID: NPC39009

Ingredient ID: NPC318354

Ingredient ID: NPC317466

Ingredient ID: NPC31311

Ingredient ID: NPC308267

Ingredient ID: NPC302642

Ingredient ID: NPC290303

Ingredient ID: NPC282420

Ingredient ID: NPC268334

Ingredient ID: NPC235625

Ingredient ID: NPC2314

Ingredient ID: NPC219225

Ingredient ID: NPC216459

Ingredient ID: NPC207757

Ingredient ID: NPC180832

Ingredient ID: NPC175214

Ingredient ID: NPC171409

Ingredient ID: NPC144015

Ingredient ID: NPC138487

Ingredient ID: NPC131204

Ingredient ID: NPC121263

Ingredient ID: NPC116895

Ingredient ID: NPC116027

Ingredient ID: NPC100079

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 2	CYP2D6	Cytochrome P450 2D6	P10635	CHEMBL289
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Enzyme	APEX1	DNA-(apurinic or apyrimidinic site) lyase	P27695	CHEMBL5619
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Nuclear hormone receptor subfamily 1	PPARG	Peroxisome proliferator-activated receptor gamma	P37231	CHEMBL235
Therapeutic Target	Oxidoreductase	MAOA	Monoamine oxidase A	P21397	CHEMBL1951
Therapeutic Target	Phosphodiesterase	TDP1	Tyrosyl-DNA phosphodiesterase 1	Q9NUW8	CHEMBL1075138
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD5	Dopamine D5 receptor	P21918	CHEMBL1850
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD4	Dopamine D4 receptor	P21917	CHEMBL219
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD3	Dopamine D3 receptor	P35462	CHEMBL234
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD2	Dopamine D2 receptor	P14416	CHEMBL217
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD1	Dopamine D1 receptor	P21728	CHEMBL2056
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Unclassified protein	SNCA	Alpha-synuclein	P37840	CHEMBL6152

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	10

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT02861261	A Study on the Efficacy and Gut Microbiota of Berberine and Probiotics in Patients With Newly Diagnosed Type 2 Diabetes	type 2 diabetes mellitus	Berberine (NPC53069)	NP level
NCT02548832	Bezafibrate Plus Berberine in Mixed Dyslipidemia	Combined hyperlipidemia	Berberine (NPC53069)	NP level
NCT03333265	Primary Chemoprevention of Familial Adenomatous Polyposis With Berberine Hydrochloride	colorectal adenoma	Berberine (NPC53069)	NP level
NCT02084004	Effects of Berberine Hydrochloride and Bifidobacterium in Diabetes Mellitus Prevention and Treatment	type 2 diabetes mellitus	Berberine (NPC53069)	NP level
NCT03281096	A Research of Berberine Hydrochloride to Prevent Colorectal Adenomas in Patients With Previous Colorectal Cancer	colorectal adenoma	Berberine (NPC53069)	NP level
NCT03486496	Gefitinib and Berberine in the First-line Treatment of Lung Adenocarcinoma With EGFR Mutation	lung adenocarcinoma	Berberine (NPC53069)	NP level
NCT02082756	Effects of Berberine Hydrochloride and Bifidobacterium in Prediabetes Prevention and Treatment	prediabetes syndrome	Berberine (NPC53069)	NP level
NCT02226185	Study of Berberine Hydrochloride in Prevention of Colorectal Adenomas Recurrence	colorectal adenoma	Berberine (NPC53069)	NP level
NCT00633282	Role of Pioglitazone and Berberine in Treatment of Non-Alcoholic Fatty Liver Disease	non-alcoholic fatty liver disease	Berberine (NPC53069)	NP level
NCT00425009	Therapeutic Effects of Berberine in Patients With Type 2 Diabetes	type 2 diabetes mellitus	Berberine (NPC53069)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	ACHE,SNCA,LMNA,DRD1,CYP1B1,POLB,DRD2,PPARG
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	SNCA,DRD4,MAOA,DRD2,DRD3,ACHE,PPARG
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	DRD4,DRD3,MAOA,SNCA,DRD2,DRD1,ACHE
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	PPARG,DRD2,DRD3,POLB,APEX1,PKM
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	SNCA,LMNA,DRD1,APEX1,TDP1,DRD2
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	PPARG,DRD2 NCT02861261,NCT02084004,NCT00425009
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	PKM,DRD5,APEX1,TDP1,DRD2
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	ACHE,LMNA,APEX1,THPO,TDP1
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	ACHE,DRD1,CYP1B1,APEX1,DRD2
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	DRD2,PPARG,DRD2,DRD1
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	MAOA,DRD2,DRD4,DRD3
Allergic/hypersensitivity disorder Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A80-4A8Z	DRD4,DRD1,DRD5,DRD2
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	DRD1,DRD3,DRD4,DRD2
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	PKM,DRD5,POLB,TDP1
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	ACHE,DRD5,SNCA,DRD2
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	DRD2,MAOA,ACHE
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	PKM,DRD2,ACHE
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	PPARG,DRD2,ACHE
Bipolar disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60	DRD4,DRD3,DRD2
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	DRD1,DRD4,DRD2
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	DRD2,DRD3,DRD4
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	NCT02226185,NCT03281096,NCT03333265
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	PKM,LMNA,DRD4
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	PKM,DRD4,PKM
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	ACHE,SNCA,LMNA
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	ACHE,DRD2,THPO
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	ACHE,THPO,CYP2D6
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	DRD1,ACHE,SNCA
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	DRD2,DRD3
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	DRD2,DRD3
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	DRD3,DRD2
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	DRD3,DRD2
Gastroduodenal motor/secretory disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA41	DRD3,DRD2
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	DRD3,DRD2
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CYP2D6,DRD2
General pain disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43	MAOA,DRD2
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE,DRD1
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	DRD2,DRD3
Acute upper respiratory infection Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA07	DRD2,DRD3
Sexual dysfunction Disease Category: 17.Conditions related to sexual health Disease ICD-11 Code: HA00-HA01	DRD3,DRD2
Non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92	PPARG NCT00633282
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	MAOA,DRD3
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	PKM,DRD5
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	DRD5,DRD4
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	ACHE,DRD4
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	DRD2,DRD4
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE,DRD2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	PKM,CYP2D6
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA,PPARG
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	LMNA,CYP1B1
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	THPO,CYP1B1
Nausea/vomiting Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD90	DRD2
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	PPARG
Inborn lipid metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52	PPARG
Ocular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D00-2D07	APEX1
Cerebral ischaemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B1Z	DRD2
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	DRD2
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Faecal incontinence Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: ME07	DRD2
Abortion Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA00	DRD1
Skin tag/polyp Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK71	MAOA
Nicotine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C4A	PPARG
Mood disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60-6E23	MAOA
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	PPARG
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	MAOA
Hypotension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA20-BA21	DRD2
Opioid use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C43	PPARG
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	PPARG
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	DRD2
Postpartum haemorrhage Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA43	DRD2
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	DRD2
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	DRD2
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	THPO
Autonomic nervous system disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8D87	SNCA
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	PPARG
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	PPARG
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	DRD2
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	DRD2
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	DRD2
Digestive system disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DE2Z	DRD2
NA Disease Category: NA Disease ICD-11 Code: NA	DRD2
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	THPO
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F40-1F45	CYP2D6
Thyrotoxicosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A02	DRD2
Cocaine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C45	DRD1
Carcinoid syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B10	DRD2
Psychoactive substances use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C4G	DRD3
Intellectual development disorder Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD90	DRD2
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	APEX1
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	DRD2
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	PPARG
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Endocrine gland neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F37	DRD2
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	PKM
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	DRD2
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	DRD2
Itching Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G07	DRD2
Migraine Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A80	DRD2
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	DRD3
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	MAOA
Inborn porphyrin/heme metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C58	DRD2
Tic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A05	DRD1
Restless legs syndrome Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A80	DRD2
Schizoaffective disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A21	DRD2
Breathing abnormality Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD11	DRD2
Gangrene Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MC85	DRD2
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	DRD2
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	PPARG
Hyperaemia Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A61-9B7Y	DRD2
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	DRD2
Sjogren syndrome Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A43	PPARG
Intermediate hyperglycaemia, unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A40.Z	NCT02082756
Mixed hyperlipidaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80.2	NCT02548832
Adenocarcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D40	NCT03486496
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	DRD5
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	DRD1
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	ACHE
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	DRD2
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	ACHE
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CYP1B1
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	THPO
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	DRD2
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	SNCA

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Symphytum Officinale

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

35 All known Ingredients in Total

31 Ingredients with Acceptable Bioavailablity

18 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Adenocarcinoma of pancreas

Alzheimer disease

Parkinsonism

Solid tumour/cancer

Mesothelioma of pleura

Type 2 diabetes mellitus

Serous cystadenoma,borderline malignancy of ovary

Diffuse large B-cell lymphomas

Malignant neoplasms of thymus

Pulmonary hypertension

Depression

Allergic/hypersensitivity disorder

Schizophrenia

Carcinosarcoma of uterus

Pheochromocytoma

Substance abuse

Pain, unspecified

Glaucoma

Bipolar disorder

Psychotic disorder

Attention deficit hyperactivity disorder

Colorectal cancer

Malignant neoplasms of biliary tract, distal bile duct

Hepatocellular carcinoma of liver

Superficial ovarian endometriosis

Cytomegaloviral disease

Adenocarcinoma of bronchus or lung

Germ cell tumour of testis

Mature T-cell lymphoma

Multiple myeloma

BCR-ABL1-negative chronic myeloid leukaemia

Stomach cancer

Gastroduodenal motor/secretory disorder

Brain cancer

Insomnia

General pain disorder

Dementia

Endometrial cancer

Acute upper respiratory infection

Sexual dysfunction

Non-alcoholic fatty liver disease

Dengue fever, unspecified

Hepatoblastoma

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Other specified malignant neoplasms of kidney, except renal pelvis

Squamous cell carcinoma of bronchus or lung

Systemic lupus erythematosus

Malignant neoplasms of corpus uteri, unspecified

Chikungunya virus disease

Glioblastoma of brain

Carpal tunnel syndrome

Nausea/vomiting

Indeterminate colitis

Inborn lipid metabolism error

Ocular cancer

Cerebral ischaemia

Anxiety

Myasthenia gravis

Faecal incontinence

Abortion

Skin tag/polyp