CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Symphytum Officinale

Example Image

PLANiTS DNA barcode

ATCTCGTCACCGCATCCCTAATNTTTTGTGTATCGGTGGAATGTGACCTCCTGCTCCTAGTTGTGCAGTTGGTTAAAACTTGAGTATGTGGATTAGGACTTCACGACAAGTGGTGGTTGGATAACAACTCTCGTCATGTCGTGTGCCAAGCCCACGTTACTTTCAAGACCCTATGGTGCAAGTTACCCTCATTTGTTTTGTTGGAAACATGTTCTATG

Taxonomic Information

Plant ID: NPO23223
Plant Latin Name: Symphytum Officinale
Taxonomy Genus: Symphytum
Taxonomy Family: Boraginaceae

Plant External Links:

NCBI TaxonomyDB: 278672
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

Madagascar; Finland; Angola; South Africa; India; Indonesia; Lithuania; Zimbabwe; China; Swaziland; Spain

Traditional Medicine System:

TCM

Medicinal Functions:

Anodyne; Antidiarrhoeal; Antirheumatic; Astringent; Demulcent; Emollient; Expectorant; Haemostatic; Homeopathy; Refrigerant; Vulnerary

Geographical Distribution

Madagascar; Indonesia; Angola; South Africa; India; Finland; Lithuania; Zimbabwe; China; Swaziland; Spain

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

35 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

31 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)