• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Bistorta Officinalis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCACAAGCAGAAAGACCCGCGAACTCGTTTACAAACACCCGAGGGGCAGGGCTCGGCCAAAACCGGCGCTGCCCCTCACACCAACGAACCCCGGCGCGGATTGCGCCAAGGACCATGAACAATAGCGCGCCGCCCGCCACTCGGTCATCCGGTGTGCGAGCGGCGACGTGTCGTTTCGATACTAACTGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCGGGCCGAGGGCACGTCTGCATGGGCGTCACGCACAGCGTCGCCCCCACCCCATCCCGTGGGGCGTGGGGCGGATTCTGGCCCCCCGTGTGCTCCCGCGCGCGGTCGGCCTAAAATCAGACCCCGTGGCCGCGAAATGCCGCGACGATTGGTGGTGTACGTGGCAGCCTTGTGCCGCCCTAACATCGCGTCGCGCCTTCCGTGGCCCTCTGGAGTCAAAAGGACCCTCGAGAGCCCTCCGCACCAGCGGAGGGGCCTCTCCACCGTT

Click for details-----ITS1

NA

Click for details-----ITS2

ACAGCGTCGCCCCCACCCCATCCCGTGGGGCGTGGGGCGGATTCTGGCCCCCCGTGTGCTCCCGCGCGCGGTCGGCCTAAAATCAGACCCCGTGGCCGCGAAATGCCGCGACGATTGGTGGTGTACGTGGCAGCCTTGTGCCGCCCTAACATCGCGTCGCGCCTTCCGTGGCCCTCTGGAGTCAAAAGGACCCTCGAGAGCCCTCCGCACCAGCGGAGGGGCCTCTCCACCGTT
Taxonomic Information

Plant ID: NPO23213
Plant Latin Name: Bistorta Officinalis
Taxonomy Genus: Bistorta
Taxonomy Family: Polygonaceae

Plant External Links:

NCBI TaxonomyDB: 125587
Plant-of-the-World-Online: 60430545-2

Used in Medicines

Country/Region:
Lithuania; Italy; India

Traditional Medicine System:
Indian Folk

Geographical Distribution

Italy; Lithuania; France; Ireland; Norway; Belarus; China; Belgium; Germany; Spain; Ukraine; Netherlands; Denmark; Poland; Finland; Morocco; Sweden; Japan; Switzerland; Russia; Bulgaria; Romania; Albania; Portugal; South Africa; India; United Kingdom; Austria; Greece; Hungary

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

130 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


102 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

91 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96218

Ingredient ID: NPC95675

Ingredient ID: NPC94196

Ingredient ID: NPC93527

Ingredient ID: NPC91765

Ingredient ID: NPC90566

Ingredient ID: NPC90232

Ingredient ID: NPC88846

Ingredient ID: NPC88759

Ingredient ID: NPC88566

Ingredient ID: NPC87125

Ingredient ID: NPC8606

Ingredient ID: NPC85813

Ingredient ID: NPC78500

Ingredient ID: NPC76145

Ingredient ID: NPC68889

Ingredient ID: NPC66655

Ingredient ID: NPC64370

Ingredient ID: NPC63121

Ingredient ID: NPC61506

Ingredient ID: NPC61477

Ingredient ID: NPC59581

Ingredient ID: NPC52403

Ingredient ID: NPC51189

Ingredient ID: NPC49615

Ingredient ID: NPC49151

Ingredient ID: NPC45674

Ingredient ID: NPC43696

Ingredient ID: NPC43114

Ingredient ID: NPC41180

Ingredient ID: NPC36835

Ingredient ID: NPC34764

Ingredient ID: NPC32279

Ingredient ID: NPC31799

Ingredient ID: NPC312734

Ingredient ID: NPC308749

Ingredient ID: NPC307875

Ingredient ID: NPC306255

Ingredient ID: NPC305660

Ingredient ID: NPC302857

Ingredient ID: NPC302327

Ingredient ID: NPC301585

Ingredient ID: NPC300649

Ingredient ID: NPC29883

Ingredient ID: NPC295777

Ingredient ID: NPC290189

Ingredient ID: NPC289974

Ingredient ID: NPC289758

Ingredient ID: NPC287379

Ingredient ID: NPC287331

Ingredient ID: NPC285554

Ingredient ID: NPC28077

Ingredient ID: NPC280254

Ingredient ID: NPC279121

Ingredient ID: NPC278683

Ingredient ID: NPC274442

Ingredient ID: NPC272902

Ingredient ID: NPC26974

Ingredient ID: NPC26906

Ingredient ID: NPC266979

Ingredient ID: NPC265705

Ingredient ID: NPC262505

Ingredient ID: NPC260491

Ingredient ID: NPC257124

Ingredient ID: NPC256186

Ingredient ID: NPC255042

Ingredient ID: NPC250539

Ingredient ID: NPC246162

Ingredient ID: NPC242117

Ingredient ID: NPC240476

Ingredient ID: NPC239406

Ingredient ID: NPC233443

Ingredient ID: NPC226511

Ingredient ID: NPC225710

Ingredient ID: NPC225346

Ingredient ID: NPC223455

Ingredient ID: NPC219876

Ingredient ID: NPC218918

Ingredient ID: NPC217226

Ingredient ID: NPC216630

Ingredient ID: NPC216127

Ingredient ID: NPC214909

Ingredient ID: NPC214584

Ingredient ID: NPC214502

Ingredient ID: NPC208075

Ingredient ID: NPC20791

Ingredient ID: NPC204932

Ingredient ID: NPC201844

Ingredient ID: NPC201622

Ingredient ID: NPC197467

Ingredient ID: NPC197356

Ingredient ID: NPC196590

Ingredient ID: NPC191217

Ingredient ID: NPC190810

Ingredient ID: NPC182840

Ingredient ID: NPC180871

Ingredient ID: NPC179831

Ingredient ID: NPC178134

Ingredient ID: NPC167976

Ingredient ID: NPC1656

Ingredient ID: NPC157410

Ingredient ID: NPC156654

Ingredient ID: NPC15658

Ingredient ID: NPC153958

Ingredient ID: NPC151759

Ingredient ID: NPC14227

Ingredient ID: NPC141699

Ingredient ID: NPC139546

Ingredient ID: NPC138113

Ingredient ID: NPC136996

Ingredient ID: NPC127878

Ingredient ID: NPC127122

Ingredient ID: NPC126509

Ingredient ID: NPC125886

Ingredient ID: NPC125144

Ingredient ID: NPC125066

Ingredient ID: NPC125062

Ingredient ID: NPC120926

Ingredient ID: NPC120775

Ingredient ID: NPC116775

Ingredient ID: NPC115632

Ingredient ID: NPC113961

Ingredient ID: NPC113928

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC110884

Ingredient ID: NPC109813

Ingredient ID: NPC108218

Ingredient ID: NPC107522

Ingredient ID: NPC104195