• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Schefflera Bodinieri


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCCCCCAACCACGCACTACCTCATGGGAGTTGTGGCAGAGGGGCGGATATTGGCCTCCCGTGTCTCACCGTGCGGTTGGCCCAAATGTGAGTCCTTGGCGACAGACGTCACGACAAGCGGTGGTTGTAAAAAAACCTTCTTCTCCTGTCGTGCGTTGACCCGTCGCCAACAAAAGCTCTTGTGACCCTTTTGTGTCGTCCCCGACGCGCACTCCGAAGGNGACCTC
Taxonomic Information

Plant ID: NPO23176
Plant Latin Name: Schefflera Bodinieri
Taxonomy Genus: Schefflera
Taxonomy Family: Araliaceae

Plant External Links:

NCBI TaxonomyDB: 1433814
Plant-of-the-World-Online: 91960-1

Used in Medicines

Unknown.

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

49 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


11 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

10 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95512

Ingredient ID: NPC89325

Ingredient ID: NPC83137

Ingredient ID: NPC80776

Ingredient ID: NPC80670

Ingredient ID: NPC7599

Ingredient ID: NPC7479

Ingredient ID: NPC74097

Ingredient ID: NPC56325

Ingredient ID: NPC54726

Ingredient ID: NPC40733

Ingredient ID: NPC38579

Ingredient ID: NPC34393

Ingredient ID: NPC306169

Ingredient ID: NPC302025

Ingredient ID: NPC296734

Ingredient ID: NPC290876

Ingredient ID: NPC288986

Ingredient ID: NPC286134

Ingredient ID: NPC280486

Ingredient ID: NPC269192

Ingredient ID: NPC264553

Ingredient ID: NPC264495

Ingredient ID: NPC258770

Ingredient ID: NPC254324

Ingredient ID: NPC25252

Ingredient ID: NPC248944

Ingredient ID: NPC24106

Ingredient ID: NPC232037

Ingredient ID: NPC230301

Ingredient ID: NPC227260

Ingredient ID: NPC220847

Ingredient ID: NPC216515

Ingredient ID: NPC209912

Ingredient ID: NPC202827

Ingredient ID: NPC196884

Ingredient ID: NPC187154

Ingredient ID: NPC170094

Ingredient ID: NPC169055

Ingredient ID: NPC161035

Ingredient ID: NPC148347

Ingredient ID: NPC141769

Ingredient ID: NPC141427

Ingredient ID: NPC13475

Ingredient ID: NPC132731

Ingredient ID: NPC12910

Ingredient ID: NPC126142

Ingredient ID: NPC119831

Ingredient ID: NPC102504