• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Primula Hirsuta


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAAACCTGCAYAGCAGAACGACCCGCGAACTTGTATCTAAACCGGGGGGACACCGGATGGGCCACCAACCTGTTTGGTGTTTTCCTCTCTGCTAGGGGTGACCCCATTGTCCGTTGTGGCATGGGTTCGCATTCCTGGCAGAACAACGAACCCCGGCGTGATCTGCGCCAAGGAAATTTAACAAAGAGATCATTCTTCCATGCTCCCGTTCGCGGGTTGCAGGAAGGAGTAGATTCTTGCATATAATAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO23057
Plant Latin Name: Primula Hirsuta
Taxonomy Genus: Primula
Taxonomy Family: Primulaceae

Plant External Links:

NCBI TaxonomyDB: 184183
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

55 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


39 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

34 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC82374

Ingredient ID: NPC7349

Ingredient ID: NPC71074

Ingredient ID: NPC68160

Ingredient ID: NPC65133

Ingredient ID: NPC61779

Ingredient ID: NPC51700

Ingredient ID: NPC49457

Ingredient ID: NPC48623

Ingredient ID: NPC36061

Ingredient ID: NPC34550

Ingredient ID: NPC32021

Ingredient ID: NPC311295

Ingredient ID: NPC31032

Ingredient ID: NPC306386

Ingredient ID: NPC30395

Ingredient ID: NPC301585

Ingredient ID: NPC29883

Ingredient ID: NPC289021

Ingredient ID: NPC282773

Ingredient ID: NPC280076

Ingredient ID: NPC279121

Ingredient ID: NPC27765

Ingredient ID: NPC272804

Ingredient ID: NPC27184

Ingredient ID: NPC269888

Ingredient ID: NPC264317

Ingredient ID: NPC261831

Ingredient ID: NPC260837

Ingredient ID: NPC25495

Ingredient ID: NPC243728

Ingredient ID: NPC239051

Ingredient ID: NPC228614

Ingredient ID: NPC224684

Ingredient ID: NPC220210

Ingredient ID: NPC219809

Ingredient ID: NPC217922

Ingredient ID: NPC212315

Ingredient ID: NPC209970

Ingredient ID: NPC209846

Ingredient ID: NPC203719

Ingredient ID: NPC195458

Ingredient ID: NPC192638

Ingredient ID: NPC18772

Ingredient ID: NPC17839

Ingredient ID: NPC178104

Ingredient ID: NPC176300

Ingredient ID: NPC171736

Ingredient ID: NPC165967

Ingredient ID: NPC165003

Ingredient ID: NPC162973

Ingredient ID: NPC162168

Ingredient ID: NPC121158

Ingredient ID: NPC115798

Ingredient ID: NPC100980