• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Aesculus Hippocastanum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCCGGCAGAACGACCCGCGAACTCTGTTTCATCGCCGGGGGGATCGCGGTCCCCCTTCCGCCGCGGGGGCAAGGGCGCCTGCGCTTGCTCCGGCGGGCGCATAACAACGAACCCCGGCGCGGACCGCGTCAAGGAATTTTAACAAGGGAGCATGCCCCTGCCGCCCCGGAAACGGTGTGCGTGCTTGTGGCGGTGCCCTTCTTCCATTATCTAAAACGACTCTCGGCAAGGGATATCTCGGCTCTCGCATCGATGAAGAAAGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCCGAACCCCTCCTCCCCGCGTCGTACGCGGGGCGGGGGGTCCCGTGGCGGGCGGAGATTGGCCTCCCGTGGGCCTCGGCCCGCGGTTGGCCCAAATACGAGTCCTCGGCGGTGTATGCCGCGGCGTTCGGGGGGGGAAAAAACCTCGAGCCCTCGCCGCGCGCACGCCGTCGGTCCAAGGCTCTGTGACCCTGAAGTGCCGTCGAAAACGCACGCATCGCGACCTCAGTC

Click for details-----ITS1

TCGAAACATGCCCGGCAGAACGACCCGCGAACTCTGTTTCATCGCCGGGGGGATCGCGGTCCCCCTTCCGTCCCCGGGGCAAGGGCGCCTGCGCTTGCCTTCCGCCGGCTGCATAACAACGAACCCCGGCGCGGACCGGGTCAAGGAATTTTAACAAGGGAGCATGCCCATGCCCCCCCGGAAACGGAATGCGTGCTTGCGGCGGTGCCCTTCTTCCATTATGTAAAA

Click for details-----ITS2

ATCGTTGCCCCCGAACCCCTCCTCCCCGCGTCGTACGCGGGGCGGGGGGTCCCGTGGCGGGCGGAGATTGGCCTCCCGTGGGCCTCGGCCCGCGGTTGGCCCAAATACGAGTCCTCGGCGGTGTATGCCGCGGCGTTCGGGGGGGGAAAAAACCTCGAGCCCTCGCCGCGCGCACGCCGTCGGTCCAAGGCTCTGTGACCCTGAAGTGCCGTCGAAAACGCACGCATCGCGACCTCAGTC
Taxonomic Information

Plant ID: NPO23044
Plant Latin Name: Aesculus Hippocastanum
Taxonomy Genus: Aesculus
Taxonomy Family: Sapindaceae

Plant External Links:

NCBI TaxonomyDB: 43364
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Italy; India; Lebanon; China; Bulgaria

Traditional Medicine System:
TCM


Medicinal Functions:

Alterative; Analgesic; Antiinflammatory; Antirheumatic; Astringent; Bach; Diuretic; Expectorant; Febrifuge; Haemostatic; Narcotic; Tonic; Vasoconstrictor; Vulnerary

Geographical Distribution

Turkey; Italy; India; Lebanon; China; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

39 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


18 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

22 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC95162

Ingredient ID: NPC84811

Ingredient ID: NPC81010

Ingredient ID: NPC70744

Ingredient ID: NPC69189

Ingredient ID: NPC67377

Ingredient ID: NPC475263

Ingredient ID: NPC473790

Ingredient ID: NPC3973

Ingredient ID: NPC317479

Ingredient ID: NPC304830

Ingredient ID: NPC29883

Ingredient ID: NPC283343

Ingredient ID: NPC276406

Ingredient ID: NPC268470

Ingredient ID: NPC265656

Ingredient ID: NPC245561

Ingredient ID: NPC237344

Ingredient ID: NPC236202

Ingredient ID: NPC219913

Ingredient ID: NPC215019

Ingredient ID: NPC212670

Ingredient ID: NPC206264

Ingredient ID: NPC186255

Ingredient ID: NPC186128

Ingredient ID: NPC173638

Ingredient ID: NPC164014

Ingredient ID: NPC159168

Ingredient ID: NPC157220

Ingredient ID: NPC154656

Ingredient ID: NPC152331

Ingredient ID: NPC141704

Ingredient ID: NPC137949

Ingredient ID: NPC137100

Ingredient ID: NPC137001

Ingredient ID: NPC124569

Ingredient ID: NPC111888

Ingredient ID: NPC108811

Ingredient ID: NPC104609

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Therapeutic Target Lyase CA9 Carbonic anhydrase IX Q16790 CHEMBL3594
Therapeutic Target Lyase CA12 Carbonic anhydrase XII O43570 CHEMBL3242
Therapeutic Target Lyase CA2 Carbonic anhydrase II P00918 CHEMBL205
Therapeutic Target Oxidoreductase ALDH1A1 Aldehyde dehydrogenase 1A1 P00352 CHEMBL3577
Therapeutic Target Small molecule receptor (family A GPCR) DRD1 Dopamine D1 receptor P21728 CHEMBL2056
Therapeutic Target Unclassified protein SNCA Alpha-synuclein P37840 CHEMBL6152
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
Plant level1
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT04035317 Aesculus Hippocastanum L. on Fontan Circulation Univentricular Heart Aesculus Hippocastanum Plant level
As single plant

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 CA12,AKR1B1,HSD17B10,CA9,ALDH1A1
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 CA2,CA9,AKR1B1,HSD17B10
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 SNCA,DRD1,CA2,CA9
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 CA12,DRD1,CA9,SNCA
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 CA12,CA9,CA12,CA9
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 AKR1B1,HSD17B10,DRD1,CA9
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 CA12,DRD1,AKR1B1,SNCA
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 CA12,CA2,CA9
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 CA2,CA9,CA12
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 CA12,CA2,CA9
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 CA2,CA9,AKR1B1
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CA12,CA2,CA9
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 CA12,CA9,SNCA
Schizophrenia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20
 AKR1B1,DRD1
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA12,CA2
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 AKR1B1,CA2
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA2,CA12
Parkinsonism
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00
 DRD1,SNCA
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 AKR1B1,CA2
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 SNCA,CA2
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 CA9,AKR1B1
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 CA12,AKR1B1
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 CA9,CA9
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 CA12,CA9
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 CA12,CA9
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 SNCA,CA2
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 CA12,CA9
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 CA2,CA9
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 CA12,CA9
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CA12,CA2
Functionally univentricular heart
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA89
 NCT04035317
Cataract
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B10
 AKR1B1
Essential hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00
 CA2
Heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10-BD1Z
 CA2
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 SNCA
Pulmonary hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BB01
 DRD1
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 AKR1B1
Renal cell carcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90
 CA9
Duodenal ulcer
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA63
 CA2
Allergic/hypersensitivity disorder
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A80-4A8Z
 DRD1
Cocaine use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C45
 DRD1
Mature T-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A90
 CA9
Insomnia
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A00-7A0Z
 CA2
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 AKR1B1
Substance abuse
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C40
 ALDH1A1
Low bone mass disorder
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB83
 CA2
Thrombosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB61-GB90
 AKR1B1
Autonomic nervous system disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8D87
 SNCA
Abortion
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA00
 DRD1
Dementia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D80-6D8Z
 DRD1
Psychotic disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20-6A25
 DRD1
Tic disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A05
 DRD1
Neuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C0Z
 AKR1B1
Osteoarthritis, unspecified
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA0Z
 CA12
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 AKR1B1
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 DRD1
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 CA9
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 CA9
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 ALDH1A1
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 CA2
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 CA9
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CA12
Parkinson disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00.0
 ALDH1A1

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group