• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Urtica Dioica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTTCCGTAGTGAACCTGCGGAAGGATCATTGTCGAACCTGCTTCATGCAAAAAACGACCCGCGAATAAGTTCTTACGTTTTGGTGGGGCGAGGATGGCTCGTTCGCGACCATTCTCGTCCCGCTCCTAACAACCAAAGGCGCGGGATGCGCCAAGGAAAATCGAAACGAATCTGACTCCTGCCTCGGTGCATTGCATCGTGTCGGCGAGTGTATTCGATAAGTCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACGTGGTGTGAATTGCAGGATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCACCGTTGCCCCCCAAACCCCCTCAGTCCTCCACGGAGGATTGGCGAGGCGCGTGGGGGGCGTAAAGTGGCTTCCCGTCGGCTTTGTCCCGCGGTTGGCCTAAAAATGAATCCCTAGCCGCGGTGCGCGCGGCATTCGGTGGTCATCGATCCCTTTCGTTACCCCGCCGCGCGCTCACGTGCCGCGAAGGATGTCACACTAGTACACCCGACGCCTCGCTTTGTG

Click for details-----ITS1

TTTCTGTAGGAGAACCTGCGGAAGGATCATTGTCGACCTGCTTCATGCAAAACGACCCGCGAATAAGTTCTTACGTTTTGGTGGGGCGAGGATGGCTCGTTCGCGACCATTCTCGTCCCGCTCCTAACAACCAAAGGCGCGGGATGCGCCAAGGAAAATCGAAACGAATCTGACTCCTGCCTCGGTGCATTGCATCGTGTCGGCGAGTGTATTCGATAAGTCATAA

Click for details-----ITS2

ACCGTTGCCCCCCAAACCCCCTCAGTCCTCCACGGAGGATTGGCGAGGCGCGTGGGGGGCGTAAAGTGGCTTCCCGTCGGCTTTGTCCCGCGGTTGGCCTAAAAATGAATCCCTAGCCGCGGTGCGCGCGGCATTCGGTGGTCATCGATCCCTTTCGTTACCCCGCCGCGCGCTCACGTGCCGCGAATGACGTCATACTAATAAACACGACTCCTCTTTTTATGAACAGAGCATATTACAAC
Taxonomic Information

Plant ID: NPO23017
Plant Latin Name: Urtica Dioica
Taxonomy Genus: Urtica
Taxonomy Family: Urticaceae

Plant External Links:

NCBI TaxonomyDB: 3501
Plant-of-the-World-Online: 260630-2

Used in Medicines

Country/Region:
Turkey; Albania; Italy; Turkmenistan; India; Finland; Lithuania; Sweden; China; Lebanon; Argentina; Spain; Bulgaria

Traditional Medicine System:
TCM; Homeopathy; Ayurveda


Medicinal Functions:

Antiasthmatic; Antidandruff; Antirheumatic; Antiseborrheic; Astringent; Diuretic; Galactogogue; Haemostatic; Hypoglycaemic; Stings; Tonic

Geographical Distribution

Brazil; Turkey; Italy; Turkmenistan; Lebanon; Lithuania; France; Ireland; Argentina; Bolivia; Norway; Belarus; Algeria; Iceland; China; Chile; Belgium; Germany; Spain; Ukraine; Eritrea; Netherlands; Libya; Denmark; Poland; Finland; United States; Morocco; Sweden; Switzerland; New Zealand; Russia; Bulgaria; Romania; Albania; Portugal; South Africa; Tunisia; India; United Kingdom; Austria; Colombia; Greece; Hungary

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

83 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


56 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

27 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC94930

Ingredient ID: NPC80466

Ingredient ID: NPC80341

Ingredient ID: NPC76336

Ingredient ID: NPC70744

Ingredient ID: NPC52015

Ingredient ID: NPC45960

Ingredient ID: NPC42372

Ingredient ID: NPC39977

Ingredient ID: NPC3780

Ingredient ID: NPC3525

Ingredient ID: NPC326623

Ingredient ID: NPC326445

Ingredient ID: NPC323787

Ingredient ID: NPC323349

Ingredient ID: NPC320263

Ingredient ID: NPC313955

Ingredient ID: NPC302857

Ingredient ID: NPC301950

Ingredient ID: NPC300478

Ingredient ID: NPC296256

Ingredient ID: NPC29601

Ingredient ID: NPC295154

Ingredient ID: NPC294902

Ingredient ID: NPC293378

Ingredient ID: NPC286620

Ingredient ID: NPC283790

Ingredient ID: NPC2785

Ingredient ID: NPC26949

Ingredient ID: NPC261230

Ingredient ID: NPC257885

Ingredient ID: NPC254274

Ingredient ID: NPC250069

Ingredient ID: NPC244016

Ingredient ID: NPC236709

Ingredient ID: NPC234086

Ingredient ID: NPC232440

Ingredient ID: NPC231324

Ingredient ID: NPC230861

Ingredient ID: NPC230367

Ingredient ID: NPC224651

Ingredient ID: NPC22098

Ingredient ID: NPC220765

Ingredient ID: NPC220089

Ingredient ID: NPC219913

Ingredient ID: NPC218109

Ingredient ID: NPC216714

Ingredient ID: NPC20791

Ingredient ID: NPC207326

Ingredient ID: NPC206500

Ingredient ID: NPC205003

Ingredient ID: NPC203719

Ingredient ID: NPC196078

Ingredient ID: NPC192402

Ingredient ID: NPC191948

Ingredient ID: NPC187911

Ingredient ID: NPC18729

Ingredient ID: NPC187011

Ingredient ID: NPC18461

Ingredient ID: NPC183815

Ingredient ID: NPC180058

Ingredient ID: NPC17810

Ingredient ID: NPC164344

Ingredient ID: NPC155659

Ingredient ID: NPC154792

Ingredient ID: NPC153739

Ingredient ID: NPC142753

Ingredient ID: NPC142703

Ingredient ID: NPC142597

Ingredient ID: NPC142589

Ingredient ID: NPC139617

Ingredient ID: NPC136281

Ingredient ID: NPC134143

Ingredient ID: NPC130754

Ingredient ID: NPC126746

Ingredient ID: NPC119090

Ingredient ID: NPC116775

Ingredient ID: NPC111132

Ingredient ID: NPC111131

Ingredient ID: NPC110942

Ingredient ID: NPC1075

Ingredient ID: NPC105178

Ingredient ID: NPC101488