CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Cephalotaxus Koreana

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TTACCGTAGGTGAACCTATGGTAGGATCATTGCCGGTTCCTATCCATGAACTGTGTAGGGGAGGTGGCACGTGCGGCCCAATCGAGATAGTTGCCTCCCCGCCCCACGCTCTCTCTAGCGTCGGGATCGGAGCCCTCCCGGGAGCTTGGCCATGCTGTAACTAGCCCCAGGCAATCTCTACGTCCCTCGCCTGTGGTCCGGGGTAATAATCTGGGAGTGCACTTAAGTGTCGTCCTCCTCGCAGTGAAGCGATGTAGGGTGTCAGTATCTGATGGCAATAGGTGTACCCGTGCGTCGGGGTAGTCTTGGCCCTGTTGTTAACCGCAGTGGCCTAGTCACTTCCCTTCGAGGTCAGTTCCTCGGGAGAGCTCCCGCAGCAGCCCGCATGGCATCATCTTCTCAGCGTGGCTTGCAAGTCACAGCTGCAACCCCCTGTTGCATCTTTGGATGTTGTGGGACAGGGACACCATCCTTTCTGTGATGCCTCCCATGAGGCTTCTTAGCCTCTGGGCCTCAGTGGGGGCGATCGTGGGATGGGACGTGTGTCACAAACACTTAACCCATTGGTGCAACTCGCGCTAAGGAACGAAAGGATAGCCGCGCGGGACTCACGCCATGCGCGTGTCGGATCCCCGGCCCAATGTGAACACGAATCTCGGCAATGGATATCTTAGCTCTCGCCACGATGAAGAATGTAGTGAAATGCGATACTTAGTGTGAATTGTAGAATCCTGTGAATCATCGAGTCTTTGAGCGCAAGTTGTGCCAAAGGCCTCAGCCGAGGGCACGTCTGCTTGGGCGTCGCACTTCAAAATCACCCCCCACCATTCTTCAGCGGGAGGAGTAGAGATGGTCGTCCGTGCCCACCATGGGCGCGGTCGGCTGAAATGAGCATGAGGTCTGTGGTCCACTCCACGACGAGCGGTGGCCCATGAGGGTCGGAGTTGGTTCATGTCAAGCGGGTGCGGCTCTATTGGCAAACTTTATCTCATGGCTGGTGTCCCGCTTGCGGGCGGGACCCGTTCGTAACCTTCCCCGTCCCCAGGTCAGGCGTGAAT

Click for details-----ITS1

Click for details-----ITS2

TTCAAAATCACCCCCCACCATTCTTCAGCGGGAGGAGTAGAGATGGTCGTCCGTGCCCACCATGGGCGCGGTCGGCTGAAATGAGCATGAGGTCTGTGGTCCACTCCACGACGAGCGGTGGCCCATGAGGGTCGGAGTTGGTTCATGTCAAGCGGGTGCGGCTCTATTGGCAAACTTTATCTCATGGCTGGTGTCCCGCTTGCGGGCGGGACCCGTTCGTAACCTTCCCCGTCCCCAGGTCAGGCGTGAAT

Taxonomic Information

Plant ID: NPO2284
Plant Latin Name: Cephalotaxus Koreana
Taxonomy Genus: Cephalotaxus
Taxonomy Family: Taxaceae

Plant External Links:

NCBI TaxonomyDB: 450880
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

12 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

3 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC71061

Ingredient ID: NPC50898

Ingredient ID: NPC471457

Ingredient ID: NPC265624

Ingredient ID: NPC248739

Ingredient ID: NPC244776

Ingredient ID: NPC215710

Ingredient ID: NPC215203

Ingredient ID: NPC173637

Ingredient ID: NPC159707

Ingredient ID: NPC14606

Ingredient ID: NPC133856

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESR2	Estrogen receptor beta	Q92731	CHEMBL242
Therapeutic Target	Oxidoreductase	HSD17B1	Estradiol 17-beta-dehydrogenase 1	P14061	CHEMBL3181
Therapeutic Target	Protein Kinase	MKNK2	MAP kinase signal-integrating kinase 2	Q9HBH9	CHEMBL4204
Therapeutic Target	Protein Kinase	CSNK2A1	Casein kinase II alpha	P68400	CHEMBL3629
Therapeutic Target	Secreted protein	THPO	Thrombopoietin	P40225	CHEMBL1293256
Therapeutic Target	Secreted protein	TTR	Transthyretin	P02766	CHEMBL3194
Therapeutic Target	Serine protease	DPP4	Dipeptidyl peptidase IV	P27487	CHEMBL284

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	THPO,CSNK2A1,ESR2,ACHE,AKR1B1,PSMB5,CSNK2A2
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	XDH,DPP4,CYP19A1,AKR1B1,PSMB5
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CSNK2A3,XDH,CSNK2A1,CYP1A2,PSMB5
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CYP1B1,XDH,TTR,DPP4,ACHE
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CYP1B1,DPP4,ACHE,AKR1B1,PSMB5
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	XDH,TTR,DPP4,ACHE,AKR1B1
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CSNK2A3,CSNK2A1,ESR2,AKR1B1
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CYP1A2,AKR1B1,TTR,HSD17B1
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	THPO,CYP1A1,ESR2,ACHE
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	THPO,XDH,TTR,ACHE
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CYP1B1,CSNK2A3,DPP4,CYP19A1
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	XDH,CSNK2A1,MKNK2
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	ESR2,CYP19A1,MKNK2
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	XDH,TTR,ACHE
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	XDH,ACHE,CYP19A1
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	DPP4,CYP19A1,ACHE
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	XDH,DPP4,CSNK2A2
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	HSD17B1,DPP4,ACHE
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CYP1B1,XDH,DPP4
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CYP1A2,TTR,CYP1A1
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	CYP1B1,THPO,DPP4
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ACHE,AKR1B1
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	ESR2,CYP19A1
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	AKR1B1,ACHE
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	AKR1B1,DPP4
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	AKR1B1,CYP19A1
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	THPO,DPP4
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	CSNK2A1,MKNK2
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	ACHE,ESR2
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CYP19A1,AKR1B1
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	DPP4,AKR1B1
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	XDH,HSD17B1
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CYP19A1,CYP19A1
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	HSD17B1,XDH
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE,CYP1A1
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	XDH,CYP1A1
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	XDH,CYP19A1
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	DPP4,CYP19A1
Prostate hyperplasia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA90	ESR2
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	DPP4
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	AKR1B1
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	THPO
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	ESR2
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	MKNK2
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	DPP4
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Menopausal disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA30	ESR2
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	ACHE
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	AKR1B1
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	XDH
Sepsis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G40-1G41	ESR2
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	DPP4
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	DPP4
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	ESR2
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	AKR1B1
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	MKNK2
Cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43	TTR
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	CYP19A1
Encephalopathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E47	XDH
Amyloidosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5D00	TTR
Vasomotor/allergic rhinitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA08	ESR2
Mineral deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B5K	XDH
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	XDH
Inborn purine/pyrimidine/nucleotide metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C55	XDH
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	XDH
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	ESR2
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	CYP19A1
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	ESR2
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	XDH
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	DPP4
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	DPP4
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CYP1A1
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CYP19A1
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CYP1A1
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CYP1A1
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	TTR
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	DPP4
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	ACHE
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	TTR
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CYP1A1
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	THPO
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Cephalotaxus Koreana

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

12 All known Ingredients in Total

3 Ingredients with Acceptable Bioavailablity

12 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Diffuse large B-cell lymphomas

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Adenocarcinoma of pancreas

Malignant neoplasms of thymus

Germ cell tumour of testis

Malignant neoplasms of biliary tract, distal bile duct

Urothelial carcinoma of bladder

Cytomegaloviral disease

Adenocarcinoma of bronchus or lung

Glioblastoma of brain

Solid tumour/cancer

Breast cancer

Pheochromocytoma

Other specified malignant neoplasms of kidney, except renal pelvis

West Nile virus infection

Mesothelioma of pleura

Superficial ovarian endometriosis

Malignant neoplasms of thyroid gland, unspecified

Renal cell carcinoma, chromophobe type

Carpal tunnel syndrome

Pain, unspecified

Cushing syndrome

Glaucoma

Acute diabete complication

Neuropathy

Myocardial infarction

Liver cancer

Alzheimer disease

Hepatoblastoma

Leishmaniasis

Squamous cell carcinoma of bronchus or lung

Hepatocellular carcinoma of liver

Other specified malignant neoplasms of bronchus or lung

Systemic lupus erythematosus

Malignant neoplasms of corpus uteri, unspecified

Chikungunya virus disease

Malignant neoplasms of adrenal gland

Prostate hyperplasia

Metabolic disorder

Thrombosis

Pediculosis

Ischaemic/haemorrhagic stroke

Substance abuse

Unspecific substance harmful effect

Indeterminate colitis

Colorectal cancer

Chronic arterial occlusive disease

Oesophageal/gastroduodenal disorder

Menopausal disorder

Coronavirus infection

Parasitic worm infestation

Parkinsonism

Autism spectrum disorder

Schizophrenia

Chronic kidney disease

Sepsis

Malignant haematopoietic neoplasm

Psoriasis

Mild neurocognitive disorder

Hyper-lipoproteinaemia

Dementia

Cataract

Rheumatoid arthritis