CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Cyperus Rotundus

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TGAACCTGCGGAAGGATCATTGTCGTCGCCYCGAAACACGACCGCGAACACGTAACGTAAAGCCTCCGGGGGGGCCTCCTCCCCGGACCCGCCGGCCCCGGSCCCTCSGGCCGGGTGCCGGAACACGGCGCGGACTGTCGCCAAGGAACACCGATCTGCCCCRGGCACGCCGCACTCCGCGGCGCCGCCGGGGCCAAGCAAACAGTACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACGCCCATCAACGCTCGGTCACCCGACCGCACGCGGACAGTGGCCCTCCGAGCCGYGTAGGCRCGGCGGGCCGAAGCGCGAGGCCGTCGACCGCGTCGGGGGCGGCAAGTGGTGGGCTACAGCGCATGCCGACCCCGACCCGCGTCGACACCCGGCCCCTAACGACCCCACGACGAGGAGACCGTCGCCGCCGCGCGACGCCTTCGGACCGATACCCCAGGTCAGGCGG

Click for details-----ITS1

TTTCCGTAGGGGGACCTGGGGAAGGATCATTTTTGTCGCCCCGAAACCCGACCGGGAACCCGTAACGTAAAGCCTCCGGGGGGGCCTCCTCCCCGGACCCGCCGGCCCCGGCCCCTCGGGCCGGGTGCCGGAACACGGCGCGGACTGTCGCCAAGGAACACCGATCTGCCCCAGGCACGCCGCACTCCGCGGCGCCGCCGGGGCCAAGCAAACAGTA

Click for details-----ITS2

GCCCATCAACGCTCGGTCACCCGACCGCACGCGGACAGTGGCCCTCCGAGCCGTGTAGGCGCGGCGGGCCGAAGCGCGAGGCCGTCGACCGCGTCGGGGGCGGCAAGTGGTGGGCTACAGCGCATGCCGACCCCGACCCGTGCCGACACCCGGCCCCTAACGACCCCACGACGAGGAGACTGTCGCCGCCGCGCGACGCCTTCGGACCGATACCCCAGGTCAGGCGGGGCCACCCGCCGAG

Taxonomic Information

Plant ID: NPO22796
Plant Latin Name: Cyperus Rotundus
Taxonomy Genus: Cyperus
Taxonomy Family: Cyperaceae

Plant External Links:

NCBI TaxonomyDB: 512623
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

Brazil; Rwanda; Philippines; Indonesia; India; Laos; Malaysia; Vietnam; Jordan; Sri Lanka; China; Kenya; Paraguay; Thailand; South Korea; Tanzania; Nigeria

Traditional Medicine System:

Sowa-Rigpa; Unani; Siddha; Ayurveda; Kampo; TCM

Medicinal Functions:

Analgesic; Antibacterial; Antibiotic; Antispasmodic; Antitussive; Aromatic; Astringent; Carminative; Contraceptive; Diaphoretic; Diuretic; Emmenagogue; Lithontripic; Sedative; Skin; Stimulant; Stomachic; Tonic; Vermifuge

Geographical Distribution

Brazil; Thailand; Philippines; Indonesia; India; Jordan; Malaysia; Rwanda; China; Sri Lanka; Vietnam; Laos; Paraguay; Kenya; Nigeria; Tanzania; South Korea

Geographical Distribution

−

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Fatty acid binding protein family	FABP4	Fatty acid binding protein adipocyte	P15090	CHEMBL2083
Therapeutic Target	Lyase	CA9	Carbonic anhydrase IX	Q16790	CHEMBL3594
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Peptide receptor (family A GPCR)	TSHR	Thyroid stimulating hormone receptor	P16473	CHEMBL1963
Therapeutic Target	Protein Kinase	MAPK1	MAP kinase ERK2	P28482	CHEMBL4040
Therapeutic Target	Small molecule receptor (family A GPCR)	CNR2	Cannabinoid CB2 receptor	P34972	CHEMBL253
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transcription factor	TP53	Cellular tumor antigen p53	P04637	CHEMBL4096

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00016536	Effects of BufferGel and PRO 2000/5 Gel in Men	HIV infection	Naphthalene (NPC291066)	NP level
NCT01119534	Comparative Efficacy of the Suppository Versus Guaiacol Suppository Versus Guaifenesin Syrup in Pediatric Patients With Cough Due the Infectious Origin	Cough	Eucalyptol (NPC287331)	NP level
NCT01531517	Study of the Efficacy of PedyPhar® Ointment on the Diabetic Foot Ulcers	diabetic foot	Panthenol (NPC326283)	NP level
NCT01533220	Efficacy of Nasal Naphazoline Hydrocloride + Pheniramine Maleate + Panthenol Compared With Naphazoline Hydrocloride in the Symptomatic Control of Nasal Congestion and Nasopharyngeal	common cold;influenza	Panthenol (NPC326283)	NP level
NCT01659580	Phase III Trial of Dantonic® (T89) Capsule to Prevent and Treat Stable Angina	angina pectoris	Borneol (NPC283655)	NP level
NCT02029118	Acupoint Application in Patients With Stable Angina Pectoris (AASAP)	angina pectoris	Borneol (NPC283655)	NP level
NCT02379468	Efficacy & Safety of Pedyphar Ointment in Diabetic Foot Ulcer Treatment	diabetic foot	Panthenol (NPC326283)	NP level
NCT04392622	d-Limonene +Radiation +Platinum Based Chemo for Xerostomia Prevention in Locally Advanced Head and Neck Squamous Cell Carcinoma	xerostomia	Limonene (NPC76145)	NP level
NCT04853082	Limonene on Regulating Metabolism-related Fatty Liver Disease (MAFLD) and Analysis of TCM Constitution	Hepatic steatosis	Limonene (NPC76145)	NP level
NCT05432284	Behavioral Pharmacology of THC and Beta-Myrcene	cannabis dependence	Myrcene (NPC138113)	NP level

Associated Disease of the Plant	Association Type & Detailed Evidence
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	TP53
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA12,F2,TSHR,CA9
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	OR51E2,F2,CNR2,CA9,LMNA
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	OR51E2,FABP5
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	F2
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2 NCT01659580,NCT02029118
Arteries/arterioles disorder Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD52	MAPK1
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	F2
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	CNR2
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	CNR2

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Cyperus Rotundus

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

255 All known Ingredients in Total

201 Ingredients with Acceptable Bioavailablity

84 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Acute myeloid leukaemia

Adenocarcinoma of bronchus or lung

Adenocarcinoma of pancreas

Adenocarcinoma of prostate

Adenocarcinoma of stomach

Angina pectoris

Arteries/arterioles disorder

Asthma

Atopic eczema

Attention deficit hyperactivity disorder

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities