• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Cyperus Rotundus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGAACCTGCGGAAGGATCATTGTCGTCGCCYCGAAACACGACCGCGAACACGTAACGTAAAGCCTCCGGGGGGGCCTCCTCCCCGGACCCGCCGGCCCCGGSCCCTCSGGCCGGGTGCCGGAACACGGCGCGGACTGTCGCCAAGGAACACCGATCTGCCCCRGGCACGCCGCACTCCGCGGCGCCGCCGGGGCCAAGCAAACAGTACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACGCCCATCAACGCTCGGTCACCCGACCGCACGCGGACAGTGGCCCTCCGAGCCGYGTAGGCRCGGCGGGCCGAAGCGCGAGGCCGTCGACCGCGTCGGGGGCGGCAAGTGGTGGGCTACAGCGCATGCCGACCCCGACCCGCGTCGACACCCGGCCCCTAACGACCCCACGACGAGGAGACCGTCGCCGCCGCGCGACGCCTTCGGACCGATACCCCAGGTCAGGCGG

Click for details-----ITS1

TTTCCGTAGGGGGACCTGGGGAAGGATCATTTTTGTCGCCCCGAAACCCGACCGGGAACCCGTAACGTAAAGCCTCCGGGGGGGCCTCCTCCCCGGACCCGCCGGCCCCGGCCCCTCGGGCCGGGTGCCGGAACACGGCGCGGACTGTCGCCAAGGAACACCGATCTGCCCCAGGCACGCCGCACTCCGCGGCGCCGCCGGGGCCAAGCAAACAGTA

Click for details-----ITS2

GCCCATCAACGCTCGGTCACCCGACCGCACGCGGACAGTGGCCCTCCGAGCCGTGTAGGCGCGGCGGGCCGAAGCGCGAGGCCGTCGACCGCGTCGGGGGCGGCAAGTGGTGGGCTACAGCGCATGCCGACCCCGACCCGTGCCGACACCCGGCCCCTAACGACCCCACGACGAGGAGACTGTCGCCGCCGCGCGACGCCTTCGGACCGATACCCCAGGTCAGGCGGGGCCACCCGCCGAG
Taxonomic Information

Plant ID: NPO22796
Plant Latin Name: Cyperus Rotundus
Taxonomy Genus: Cyperus
Taxonomy Family: Cyperaceae

Plant External Links:

NCBI TaxonomyDB: 512623
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Brazil; Rwanda; Philippines; Indonesia; India; Laos; Malaysia; Vietnam; Jordan; Sri Lanka; China; Kenya; Paraguay; Thailand; South Korea; Tanzania; Nigeria

Traditional Medicine System:
Sowa-Rigpa; Unani; Siddha; Ayurveda; Kampo; TCM


Medicinal Functions:

Analgesic; Antibacterial; Antibiotic; Antispasmodic; Antitussive; Aromatic; Astringent; Carminative; Contraceptive; Diaphoretic; Diuretic; Emmenagogue; Lithontripic; Sedative; Skin; Stimulant; Stomachic; Tonic; Vermifuge

Geographical Distribution

Brazil; Thailand; Philippines; Indonesia; India; Jordan; Malaysia; Rwanda; China; Sri Lanka; Vietnam; Laos; Paraguay; Kenya; Nigeria; Tanzania; South Korea

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

255 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


201 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

84 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99655

Ingredient ID: NPC99480

Ingredient ID: NPC97192

Ingredient ID: NPC96793

Ingredient ID: NPC96630

Ingredient ID: NPC95969

Ingredient ID: NPC95675

Ingredient ID: NPC92888

Ingredient ID: NPC91574

Ingredient ID: NPC90803

Ingredient ID: NPC90701

Ingredient ID: NPC90528

Ingredient ID: NPC90506

Ingredient ID: NPC89069

Ingredient ID: NPC8881

Ingredient ID: NPC88566

Ingredient ID: NPC87699

Ingredient ID: NPC87384

Ingredient ID: NPC86939

Ingredient ID: NPC86683

Ingredient ID: NPC86564

Ingredient ID: NPC8640

Ingredient ID: NPC84953

Ingredient ID: NPC84443

Ingredient ID: NPC8075

Ingredient ID: NPC7965

Ingredient ID: NPC79219

Ingredient ID: NPC78551

Ingredient ID: NPC76817

Ingredient ID: NPC7639

Ingredient ID: NPC76145

Ingredient ID: NPC7568

Ingredient ID: NPC75158

Ingredient ID: NPC75121

Ingredient ID: NPC7491

Ingredient ID: NPC72181

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC68656

Ingredient ID: NPC6697

Ingredient ID: NPC66577

Ingredient ID: NPC62135

Ingredient ID: NPC62086

Ingredient ID: NPC58970

Ingredient ID: NPC57877

Ingredient ID: NPC56905

Ingredient ID: NPC52431

Ingredient ID: NPC52230

Ingredient ID: NPC50450

Ingredient ID: NPC48638

Ingredient ID: NPC481663

Ingredient ID: NPC46587

Ingredient ID: NPC45727

Ingredient ID: NPC41865

Ingredient ID: NPC41385

Ingredient ID: NPC38751

Ingredient ID: NPC3824

Ingredient ID: NPC3649

Ingredient ID: NPC36408

Ingredient ID: NPC34764

Ingredient ID: NPC34440

Ingredient ID: NPC329121

Ingredient ID: NPC329047

Ingredient ID: NPC32643

Ingredient ID: NPC326283

Ingredient ID: NPC326143

Ingredient ID: NPC325044

Ingredient ID: NPC323663

Ingredient ID: NPC323424

Ingredient ID: NPC322394

Ingredient ID: NPC320738

Ingredient ID: NPC320649

Ingredient ID: NPC319454

Ingredient ID: NPC319305

Ingredient ID: NPC31415

Ingredient ID: NPC310228

Ingredient ID: NPC30853

Ingredient ID: NPC308218

Ingredient ID: NPC308108

Ingredient ID: NPC307815

Ingredient ID: NPC307345

Ingredient ID: NPC307216

Ingredient ID: NPC306990

Ingredient ID: NPC305219

Ingredient ID: NPC30430

Ingredient ID: NPC303422

Ingredient ID: NPC298936

Ingredient ID: NPC297422

Ingredient ID: NPC296451

Ingredient ID: NPC294136

Ingredient ID: NPC292092

Ingredient ID: NPC291066

Ingredient ID: NPC290905

Ingredient ID: NPC290613

Ingredient ID: NPC290082

Ingredient ID: NPC290078

Ingredient ID: NPC29

Ingredient ID: NPC289366

Ingredient ID: NPC289120

Ingredient ID: NPC288826

Ingredient ID: NPC288390

Ingredient ID: NPC287660

Ingredient ID: NPC287331

Ingredient ID: NPC285371

Ingredient ID: NPC284927

Ingredient ID: NPC284731

Ingredient ID: NPC283824

Ingredient ID: NPC283655

Ingredient ID: NPC280320

Ingredient ID: NPC279969

Ingredient ID: NPC279404

Ingredient ID: NPC279183

Ingredient ID: NPC277736

Ingredient ID: NPC277

Ingredient ID: NPC274681

Ingredient ID: NPC272493

Ingredient ID: NPC26960

Ingredient ID: NPC26906

Ingredient ID: NPC266603

Ingredient ID: NPC262189

Ingredient ID: NPC260756

Ingredient ID: NPC254156

Ingredient ID: NPC25339

Ingredient ID: NPC25275

Ingredient ID: NPC252539

Ingredient ID: NPC252067

Ingredient ID: NPC251666

Ingredient ID: NPC249815

Ingredient ID: NPC247898

Ingredient ID: NPC246543

Ingredient ID: NPC246165

Ingredient ID: NPC246125

Ingredient ID: NPC243728

Ingredient ID: NPC241784

Ingredient ID: NPC241548

Ingredient ID: NPC241110

Ingredient ID: NPC239037

Ingredient ID: NPC238739

Ingredient ID: NPC238475

Ingredient ID: NPC238165

Ingredient ID: NPC236602

Ingredient ID: NPC236038

Ingredient ID: NPC232375

Ingredient ID: NPC232247

Ingredient ID: NPC231738

Ingredient ID: NPC230301

Ingredient ID: NPC230291

Ingredient ID: NPC229403

Ingredient ID: NPC22922

Ingredient ID: NPC227670

Ingredient ID: NPC226656

Ingredient ID: NPC22484

Ingredient ID: NPC224777

Ingredient ID: NPC224374

Ingredient ID: NPC22229

Ingredient ID: NPC220972

Ingredient ID: NPC220860

Ingredient ID: NPC216630

Ingredient ID: NPC214584

Ingredient ID: NPC213842

Ingredient ID: NPC213152

Ingredient ID: NPC212070

Ingredient ID: NPC209275

Ingredient ID: NPC208119

Ingredient ID: NPC20742

Ingredient ID: NPC205626

Ingredient ID: NPC200689

Ingredient ID: NPC196711

Ingredient ID: NPC196490

Ingredient ID: NPC194688

Ingredient ID: NPC193180

Ingredient ID: NPC190810

Ingredient ID: NPC190232

Ingredient ID: NPC19003

Ingredient ID: NPC189853

Ingredient ID: NPC189036

Ingredient ID: NPC188238

Ingredient ID: NPC184236

Ingredient ID: NPC184078

Ingredient ID: NPC184049

Ingredient ID: NPC183067

Ingredient ID: NPC182102

Ingredient ID: NPC180684

Ingredient ID: NPC178223

Ingredient ID: NPC177112

Ingredient ID: NPC176819

Ingredient ID: NPC176589

Ingredient ID: NPC173203

Ingredient ID: NPC171407

Ingredient ID: NPC170799

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC163984

Ingredient ID: NPC163508

Ingredient ID: NPC161759

Ingredient ID: NPC16157

Ingredient ID: NPC160996

Ingredient ID: NPC16070

Ingredient ID: NPC15659

Ingredient ID: NPC154466

Ingredient ID: NPC150713

Ingredient ID: NPC150329

Ingredient ID: NPC14682

Ingredient ID: NPC146610

Ingredient ID: NPC146522

Ingredient ID: NPC145951

Ingredient ID: NPC14594

Ingredient ID: NPC14426

Ingredient ID: NPC143639

Ingredient ID: NPC143438

Ingredient ID: NPC143011

Ingredient ID: NPC141777

Ingredient ID: NPC141229

Ingredient ID: NPC13991

Ingredient ID: NPC139182

Ingredient ID: NPC138347

Ingredient ID: NPC138306

Ingredient ID: NPC138113

Ingredient ID: NPC137949

Ingredient ID: NPC13789

Ingredient ID: NPC136248

Ingredient ID: NPC135294

Ingredient ID: NPC132343

Ingredient ID: NPC131769

Ingredient ID: NPC130439

Ingredient ID: NPC128575

Ingredient ID: NPC127582

Ingredient ID: NPC125737

Ingredient ID: NPC125085

Ingredient ID: NPC124502

Ingredient ID: NPC12269

Ingredient ID: NPC122487

Ingredient ID: NPC119969

Ingredient ID: NPC118740

Ingredient ID: NPC1179

Ingredient ID: NPC117514

Ingredient ID: NPC117493

Ingredient ID: NPC117345

Ingredient ID: NPC117253

Ingredient ID: NPC116949

Ingredient ID: NPC116366

Ingredient ID: NPC114764

Ingredient ID: NPC114519

Ingredient ID: NPC114239

Ingredient ID: NPC113733

Ingredient ID: NPC109813

Ingredient ID: NPC108945

Ingredient ID: NPC107540

Ingredient ID: NPC106250

Ingredient ID: NPC105888

Ingredient ID: NPC105585

Ingredient ID: NPC104509

Ingredient ID: NPC104080

Ingredient ID: NPC101285

Ingredient ID: NPC100879