• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Lens Culinaris


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATGCCTTACATGCAGTCCAACACGTGAATCGGTTTGAACACATACGGCGGGCTTGAGGTGTTCCACACCTCGGCTTACGTCTGGTCTGGAGGCGGCCGACGAAGTGCGTTCTCCTCCGTGCCAAAACTCAAATCCCGGCGCTGAATGCGTCAAGGAAATTAAATTTTGCTCTGAGCGCACCTGCATGGCACCGGAGACGGTTTCGTGCGGGTTGTGTTTTGACACATGATATAGAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCGAAGCCTCCTGCCAATTTCCTTTTGACGGGTATTGCGCACGGTGGATGTTGGCCTCCCGTGAGCTCTTTCGTCTCATGGTTGGTTGAAAATTGAGACCTTGGTAGGGTGTGCCATGATAGATGGTGGTTGTGTGACCCACGAGACCAATCATGCGCTGCCCTATTGAATTTGGCCTCTTTTACCCATATGCGTTTCTAAACGCTCGTGA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGAAGCCTCCTGCCAATTTCCTTTTGACGGGTATTGCGCACGGTGGATGTTGGCCTCCCGTGAGCTCTTTCGTCTCATGGTTGGTTGAAAATTGAGACCTTGGTAGGGTGTGCCATGATAGATGGTGGTTGTGTGACCCACGAGACCAATCATGCGCTGCCCTATTGAATTTGGCCTCTTTTACCCATATGCGTTTCTAAACGCTCGTGATGAGACCTCAGGTCAGGCGGGACTACCC
Taxonomic Information

Plant ID: NPO22782
Plant Latin Name: Lens Culinaris
Taxonomy Genus: Lens
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 3864
Plant-of-the-World-Online: 30001819-2

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
Indian Folk; TCM; Unani; Ayurveda; Siddha


Medicinal Functions:

Laxative; Poultice

Geographical Distribution

Turkey; Afghanistan; Italy; Bangladesh; Nepal; Mongolia; France; Ethiopia; Ecuador; Australia; Iran; Algeria; Zimbabwe; China; Germany; Iraq; Kazakhstan; Spain; Ukraine; Libya; Tanzania; Mauritius; Morocco; Belarus; Kenya; Switzerland; Yemen; Russia; Bulgaria; Pakistan; Romania; Albania; Portugal; Tunisia; Tajikistan; India; Uzbekistan; Austria; Vietnam; Mozambique; Colombia; Greece; Sri Lanka; Hungary; Cyprus

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

120 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


79 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

74 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC90167

Ingredient ID: NPC85813

Ingredient ID: NPC83720

Ingredient ID: NPC81200

Ingredient ID: NPC81010

Ingredient ID: NPC80512

Ingredient ID: NPC78625

Ingredient ID: NPC76336

Ingredient ID: NPC73855

Ingredient ID: NPC71631

Ingredient ID: NPC7096

Ingredient ID: NPC70744

Ingredient ID: NPC62045

Ingredient ID: NPC60151

Ingredient ID: NPC58190

Ingredient ID: NPC55412

Ingredient ID: NPC55167

Ingredient ID: NPC52601

Ingredient ID: NPC491227

Ingredient ID: NPC491222

Ingredient ID: NPC490472

Ingredient ID: NPC490424

Ingredient ID: NPC490409

Ingredient ID: NPC490356

Ingredient ID: NPC490354

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC489899

Ingredient ID: NPC48623

Ingredient ID: NPC48514

Ingredient ID: NPC424

Ingredient ID: NPC39426

Ingredient ID: NPC37407

Ingredient ID: NPC328447

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC304272

Ingredient ID: NPC303422

Ingredient ID: NPC29883

Ingredient ID: NPC295644

Ingredient ID: NPC294548

Ingredient ID: NPC290319

Ingredient ID: NPC287363

Ingredient ID: NPC281686

Ingredient ID: NPC279121

Ingredient ID: NPC279026

Ingredient ID: NPC277174

Ingredient ID: NPC272614

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC268342

Ingredient ID: NPC265305

Ingredient ID: NPC261831

Ingredient ID: NPC255368

Ingredient ID: NPC246558

Ingredient ID: NPC24654

Ingredient ID: NPC245582

Ingredient ID: NPC242946

Ingredient ID: NPC242580

Ingredient ID: NPC240779

Ingredient ID: NPC240428

Ingredient ID: NPC237812

Ingredient ID: NPC236658

Ingredient ID: NPC236202

Ingredient ID: NPC230301

Ingredient ID: NPC229625

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225710

Ingredient ID: NPC219876

Ingredient ID: NPC219143

Ingredient ID: NPC21632

Ingredient ID: NPC215122

Ingredient ID: NPC213876

Ingredient ID: NPC210003

Ingredient ID: NPC208793

Ingredient ID: NPC203468

Ingredient ID: NPC201844

Ingredient ID: NPC201284

Ingredient ID: NPC199072

Ingredient ID: NPC195304

Ingredient ID: NPC189436

Ingredient ID: NPC189142

Ingredient ID: NPC187770

Ingredient ID: NPC186732

Ingredient ID: NPC185755

Ingredient ID: NPC179950

Ingredient ID: NPC178134

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC174246

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC162742

Ingredient ID: NPC158537

Ingredient ID: NPC156654

Ingredient ID: NPC155263

Ingredient ID: NPC154186

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC149905

Ingredient ID: NPC147983

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC133671

Ingredient ID: NPC130683

Ingredient ID: NPC126681

Ingredient ID: NPC126029

Ingredient ID: NPC123965

Ingredient ID: NPC122809

Ingredient ID: NPC120649

Ingredient ID: NPC118990

Ingredient ID: NPC11433

Ingredient ID: NPC113733

Ingredient ID: NPC113212

Ingredient ID: NPC112890

Ingredient ID: NPC111611

Ingredient ID: NPC100697