• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Alpinia Oxyphylla


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCAAAGCAGACCGCGAACCCGTGCATAACTAACGACGTGTGGCGCGGCGCGGGGGGYGACCCCCCGTCGAGCCACCGTATCCCCGCCGGCGTCCTCCCTCGGGTCGCGTCGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACAAAAAACGAAGCGCCCGCCCCCCGCACCCCGTCCGCGGTGCGTGCGGGGGATCGGCCGTCTATCAAAATGTCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCRTCGCCCCCRTCCCCGTGCACAGCACGGYCGAGGTGGGGCGGATATTGGCCCCCCGTGTGCCCCGGYGCGCRGTCGGCCCAAATGCGATCCCCCGGCGACTCGTGTCGCGACAAGTGGTGGTTGAACATATCAATTCGCCGTCGCGCTCCTGTGTCGTCCGACGGGCATCACTGAACGACCCAACGGTGTTTGTGCACCTTCGACCGCGACCCC

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCRTCGCCCCCRTCCCCGTGCACAGCACGGYCGAGGTGGGGCGGATATTGGCCCCCCGTGTGCCCCGGYGCGCRGTCGGCCCAAATGCGATCCCCCGGCGACTCGTGTCGCGACAAGTGGTGGTTGAACATATCAATTCGCCGTCGCGCTCCTGTGTCGTCCGACGGGCATCACTGAACGACCCAACGGTGTTTGTGCACCTTCGACCGCGACCCC
Taxonomic Information

Plant ID: NPO22715
Plant Latin Name: Alpinia Oxyphylla
Taxonomy Genus: Alpinia
Taxonomy Family: Zingiberaceae

Plant External Links:

NCBI TaxonomyDB: 125261
Plant-of-the-World-Online: 795356-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

Vietnam; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

163 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


134 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

77 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99445

Ingredient ID: NPC96484

Ingredient ID: NPC95969

Ingredient ID: NPC95701

Ingredient ID: NPC94818

Ingredient ID: NPC93699

Ingredient ID: NPC91980

Ingredient ID: NPC91574

Ingredient ID: NPC90803

Ingredient ID: NPC90506

Ingredient ID: NPC88566

Ingredient ID: NPC86683

Ingredient ID: NPC86324

Ingredient ID: NPC86268

Ingredient ID: NPC85813

Ingredient ID: NPC84790

Ingredient ID: NPC81615

Ingredient ID: NPC78551

Ingredient ID: NPC78540

Ingredient ID: NPC7698

Ingredient ID: NPC7491

Ingredient ID: NPC74898

Ingredient ID: NPC74304

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC710

Ingredient ID: NPC68889

Ingredient ID: NPC68656

Ingredient ID: NPC66764

Ingredient ID: NPC62086

Ingredient ID: NPC61773

Ingredient ID: NPC60951

Ingredient ID: NPC55969

Ingredient ID: NPC53877

Ingredient ID: NPC52607

Ingredient ID: NPC4817

Ingredient ID: NPC470299

Ingredient ID: NPC470298

Ingredient ID: NPC46206

Ingredient ID: NPC41385

Ingredient ID: NPC41348

Ingredient ID: NPC36061

Ingredient ID: NPC319454

Ingredient ID: NPC309697

Ingredient ID: NPC308038

Ingredient ID: NPC307815

Ingredient ID: NPC305986

Ingredient ID: NPC297422

Ingredient ID: NPC294578

Ingredient ID: NPC294548

Ingredient ID: NPC294230

Ingredient ID: NPC29353

Ingredient ID: NPC292832

Ingredient ID: NPC292452

Ingredient ID: NPC290078

Ingredient ID: NPC289120

Ingredient ID: NPC287331

Ingredient ID: NPC287290

Ingredient ID: NPC28685

Ingredient ID: NPC283824

Ingredient ID: NPC281138

Ingredient ID: NPC277736

Ingredient ID: NPC274995

Ingredient ID: NPC274248

Ingredient ID: NPC271276

Ingredient ID: NPC271240

Ingredient ID: NPC266193

Ingredient ID: NPC264803

Ingredient ID: NPC263582

Ingredient ID: NPC262916

Ingredient ID: NPC262561

Ingredient ID: NPC261831

Ingredient ID: NPC257666

Ingredient ID: NPC255170

Ingredient ID: NPC253455

Ingredient ID: NPC251475

Ingredient ID: NPC249815

Ingredient ID: NPC247586

Ingredient ID: NPC247524

Ingredient ID: NPC246543

Ingredient ID: NPC245795

Ingredient ID: NPC24491

Ingredient ID: NPC244790

Ingredient ID: NPC243728

Ingredient ID: NPC243083

Ingredient ID: NPC242211

Ingredient ID: NPC241838

Ingredient ID: NPC241784

Ingredient ID: NPC241337

Ingredient ID: NPC239037

Ingredient ID: NPC230301

Ingredient ID: NPC229497

Ingredient ID: NPC227632

Ingredient ID: NPC224493

Ingredient ID: NPC223114

Ingredient ID: NPC215914

Ingredient ID: NPC214280

Ingredient ID: NPC208791

Ingredient ID: NPC206571

Ingredient ID: NPC20573

Ingredient ID: NPC203829

Ingredient ID: NPC203674

Ingredient ID: NPC200950

Ingredient ID: NPC197114

Ingredient ID: NPC189290

Ingredient ID: NPC188344

Ingredient ID: NPC188238

Ingredient ID: NPC185444

Ingredient ID: NPC1838

Ingredient ID: NPC183670

Ingredient ID: NPC182945

Ingredient ID: NPC182420

Ingredient ID: NPC181153

Ingredient ID: NPC180871

Ingredient ID: NPC180203

Ingredient ID: NPC178852

Ingredient ID: NPC177112

Ingredient ID: NPC171450

Ingredient ID: NPC17052

Ingredient ID: NPC169941

Ingredient ID: NPC169275

Ingredient ID: NPC168514

Ingredient ID: NPC16828

Ingredient ID: NPC167400

Ingredient ID: NPC165967

Ingredient ID: NPC1656

Ingredient ID: NPC163624

Ingredient ID: NPC163296

Ingredient ID: NPC162236

Ingredient ID: NPC161788

Ingredient ID: NPC16157

Ingredient ID: NPC16070

Ingredient ID: NPC158916

Ingredient ID: NPC156654

Ingredient ID: NPC152042

Ingredient ID: NPC146197

Ingredient ID: NPC143799

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC139207

Ingredient ID: NPC139029

Ingredient ID: NPC13789

Ingredient ID: NPC135294

Ingredient ID: NPC134609

Ingredient ID: NPC132065

Ingredient ID: NPC130017

Ingredient ID: NPC127582

Ingredient ID: NPC127447

Ingredient ID: NPC123991

Ingredient ID: NPC12269

Ingredient ID: NPC120104

Ingredient ID: NPC119969

Ingredient ID: NPC117572

Ingredient ID: NPC117237

Ingredient ID: NPC115723

Ingredient ID: NPC114239

Ingredient ID: NPC110150

Ingredient ID: NPC10855

Ingredient ID: NPC106250

Ingredient ID: NPC105585

Ingredient ID: NPC104565

Ingredient ID: NPC103308

Ingredient ID: NPC101285