• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Polygonum Salicifolium


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAAACCTGCACAAGCAGAAAGACCCGTGAACTCGTTTACAAACACCGGGCGGACGTCGTTCGGCCACAAACCGACGACGTCCCCCGAGCTCGGCAGGATCCCGGCTCCCAATGGATCGGTCTCCTCCGAGCACGAACAAACCCCGGCGCGGATTGCGCCAAGGACCATGAACAATAGCGCGTCCCACGCCCCTCGGTTGCCCGAAGTGCGCGTGGGTCGTCGTGTCGTTTCGATACATTAGAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO22676
Plant Latin Name: Polygonum Salicifolium
Taxonomy Genus: Polygonum
Taxonomy Family: Polygonaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Kenya; Tanzania; Rwanda

Traditional Medicine System:

Geographical Distribution

Turkey; Kenya; Tanzania; Rwanda

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

10 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


6 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

4 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC5903

Ingredient ID: NPC55832

Ingredient ID: NPC42716

Ingredient ID: NPC300798

Ingredient ID: NPC235260

Ingredient ID: NPC171396

Ingredient ID: NPC161375

Ingredient ID: NPC143121

Ingredient ID: NPC123383

Ingredient ID: NPC11795