• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Coptis Deltoidea


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CATTGTCGAAACCTGCTCTGCAGAACGACCCGCGAACGAGTAAACAAAACCGGTATGGGTCCGAGGCGGGATTACCCTATTCGTTCCCATGCACGCCGGGGAAGCCGGACTGCTCGGTCCTGCAGCGATGCGGGCCTTTCCGTCCGTGCCCGTCCCTGGCAAACACAAAACCCGGCGCGGTCTGCGCCAAGGAAATTCTAGCGGAAACAACGTGTTGCCATCCGCCTGCGGCGGGCAACTCGGATCCGATACTCTAACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTTAGGCCGAGGGCACGTCTGCCTGGGCATCACGCACAGCGTCGCACCCCGCCACTCTTGCTGGACGGGGAGCGGAGATTGGCCCCCCAGGCACCCGTTGCCTGGTCGGCTCAAATGATTGTCCCCGGCGACGAGCGTCGCTATCGTGGTGGATCAAAAGCTAAGATAGAGGCAGTCTCGCCGCCACAGTAGGGACAGACCGACCCCCGGACGCCGTCACCGACGGCGTTCACC

Click for details-----ITS1

CATTGTCGAAACCTGCTCTGCAGAACGACCCGCGAACGAGTAAACAAAACCGGTATGGGTCCGAGGCGGGATTACCCTATTCGTTCCCATGCACGTCGGGGCAGCCGGACTGCTCGGTTCTGCAGCGATGCGGGCCGTGCAGTCCGTGCCCGTCCCTGGCAAACACAAAACCCGGCGCGGTCTGCGCCAAGGAAATTCTAGCGGAAACAACGTGTTGCCATCCGCCTGCGGCGGGCAACTCGGATCCGATACTCTAA

Click for details-----ITS2

ACAGCGTCGCACCCCGCCACTCTTGCTGGACGGGGAGCGGAGATTGGCCCCCCGGGCACCCGTTGCCCGGTCGGCTCAAATGATTGTCCCCGGCGACGAGCGTCGCTATCGTGGTGGATCAAAAGCTAAGATAGAGGCAGTCGCGCCGCCACAGTAGGGACAGACCGACCCCCGGACGCCGTCACCGACGGCGTTCACC
Taxonomic Information

Plant ID: NPO22622
Plant Latin Name: Coptis Deltoidea
Taxonomy Genus: Coptis
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: 261449
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
TCM


Medicinal Functions:

Analgesic; Antidote; Antipyretic; Antiseptic; Cholagogue; Sedative; Vasodilator

Geographical Distribution

India; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

168 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


138 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

89 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99572

Ingredient ID: NPC99480

Ingredient ID: NPC98356

Ingredient ID: NPC96405

Ingredient ID: NPC92943

Ingredient ID: NPC92869

Ingredient ID: NPC91382

Ingredient ID: NPC89402

Ingredient ID: NPC88864

Ingredient ID: NPC88566

Ingredient ID: NPC87125

Ingredient ID: NPC85210

Ingredient ID: NPC83511

Ingredient ID: NPC81218

Ingredient ID: NPC80167

Ingredient ID: NPC79549

Ingredient ID: NPC77572

Ingredient ID: NPC74539

Ingredient ID: NPC73980

Ingredient ID: NPC73020

Ingredient ID: NPC72042

Ingredient ID: NPC71339

Ingredient ID: NPC70744

Ingredient ID: NPC70691

Ingredient ID: NPC65134

Ingredient ID: NPC59567

Ingredient ID: NPC57512

Ingredient ID: NPC53559

Ingredient ID: NPC53069

Ingredient ID: NPC52230

Ingredient ID: NPC502

Ingredient ID: NPC49074

Ingredient ID: NPC4669

Ingredient ID: NPC46254

Ingredient ID: NPC44101

Ingredient ID: NPC43246

Ingredient ID: NPC4071

Ingredient ID: NPC40432

Ingredient ID: NPC38742

Ingredient ID: NPC3855

Ingredient ID: NPC38212

Ingredient ID: NPC36229

Ingredient ID: NPC33415

Ingredient ID: NPC32991

Ingredient ID: NPC3295

Ingredient ID: NPC31860

Ingredient ID: NPC31279

Ingredient ID: NPC312132

Ingredient ID: NPC311783

Ingredient ID: NPC311255

Ingredient ID: NPC307312

Ingredient ID: NPC307050

Ingredient ID: NPC306669

Ingredient ID: NPC305327

Ingredient ID: NPC302857

Ingredient ID: NPC296482

Ingredient ID: NPC296071

Ingredient ID: NPC294100

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC28828

Ingredient ID: NPC283170

Ingredient ID: NPC269699

Ingredient ID: NPC269242

Ingredient ID: NPC26906

Ingredient ID: NPC268334

Ingredient ID: NPC266144

Ingredient ID: NPC264784

Ingredient ID: NPC263089

Ingredient ID: NPC261644

Ingredient ID: NPC259732

Ingredient ID: NPC258476

Ingredient ID: NPC257582

Ingredient ID: NPC257124

Ingredient ID: NPC252587

Ingredient ID: NPC252126

Ingredient ID: NPC251666

Ingredient ID: NPC251651

Ingredient ID: NPC247553

Ingredient ID: NPC246543

Ingredient ID: NPC244315

Ingredient ID: NPC243044

Ingredient ID: NPC23962

Ingredient ID: NPC239039

Ingredient ID: NPC235260

Ingredient ID: NPC235190

Ingredient ID: NPC232375

Ingredient ID: NPC232141

Ingredient ID: NPC230301

Ingredient ID: NPC228346

Ingredient ID: NPC225709

Ingredient ID: NPC216825

Ingredient ID: NPC215098

Ingredient ID: NPC214971

Ingredient ID: NPC214584

Ingredient ID: NPC210456

Ingredient ID: NPC210437

Ingredient ID: NPC209593

Ingredient ID: NPC207721

Ingredient ID: NPC204388

Ingredient ID: NPC202992

Ingredient ID: NPC202768

Ingredient ID: NPC202605

Ingredient ID: NPC200838

Ingredient ID: NPC200555

Ingredient ID: NPC196548

Ingredient ID: NPC196026

Ingredient ID: NPC195355

Ingredient ID: NPC193180

Ingredient ID: NPC192135

Ingredient ID: NPC191103

Ingredient ID: NPC19003

Ingredient ID: NPC189853

Ingredient ID: NPC187998

Ingredient ID: NPC184049

Ingredient ID: NPC183485

Ingredient ID: NPC182468

Ingredient ID: NPC179987

Ingredient ID: NPC179704

Ingredient ID: NPC176819

Ingredient ID: NPC175771

Ingredient ID: NPC172625

Ingredient ID: NPC171409

Ingredient ID: NPC168290

Ingredient ID: NPC167976

Ingredient ID: NPC16567

Ingredient ID: NPC16452

Ingredient ID: NPC164203

Ingredient ID: NPC163984

Ingredient ID: NPC161557

Ingredient ID: NPC161097

Ingredient ID: NPC16107

Ingredient ID: NPC158494

Ingredient ID: NPC158079

Ingredient ID: NPC157340

Ingredient ID: NPC152384

Ingredient ID: NPC14622

Ingredient ID: NPC145463

Ingredient ID: NPC143639

Ingredient ID: NPC13990

Ingredient ID: NPC138347

Ingredient ID: NPC13826

Ingredient ID: NPC138113

Ingredient ID: NPC137949

Ingredient ID: NPC136014

Ingredient ID: NPC13449

Ingredient ID: NPC13304

Ingredient ID: NPC132658

Ingredient ID: NPC131624

Ingredient ID: NPC13143

Ingredient ID: NPC126409

Ingredient ID: NPC125085

Ingredient ID: NPC124302

Ingredient ID: NPC121539

Ingredient ID: NPC12053

Ingredient ID: NPC117299

Ingredient ID: NPC116007

Ingredient ID: NPC115919

Ingredient ID: NPC115207

Ingredient ID: NPC114721

Ingredient ID: NPC112704

Ingredient ID: NPC111888

Ingredient ID: NPC111690

Ingredient ID: NPC106786

Ingredient ID: NPC106295

Ingredient ID: NPC104190

Ingredient ID: NPC102091

Ingredient ID: NPC100773