• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Trapa Bicornis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAATCCTGCAAAAAAATGCAGACAGACCAGCGAACTCATTGCCAACAATCCTGGCCGGGCTTTGCCCCGCTGCCACCGGGGGACGGGAGTGCCTCGCTGCACTTGCTCTCCTCGTAACGCAACCCCCGGCGCGGTATGCGCCAAGGAACATTGGAACACGATGGCGAGCACGTCCCGGGGCACATCCACCATGTGGCTTGCCCGGGGTATCATGCCTGTCTCTAGTATGACAACAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO22595
Plant Latin Name: Trapa Bicornis
Taxonomy Genus: Trapa
Taxonomy Family: Lythraceae

Plant External Links:

NCBI TaxonomyDB: 236974
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
India

Traditional Medicine System:
Indian Folk; Unani; Ayurveda; Siddha


Medicinal Functions:

Antipyretic; Astringent; Cancer; Tonic

Geographical Distribution

India

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

45 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


34 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

30 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC85813

Ingredient ID: NPC7965

Ingredient ID: NPC71639

Ingredient ID: NPC67508

Ingredient ID: NPC62290

Ingredient ID: NPC57788

Ingredient ID: NPC54321

Ingredient ID: NPC54145

Ingredient ID: NPC51700

Ingredient ID: NPC49168

Ingredient ID: NPC47844

Ingredient ID: NPC43276

Ingredient ID: NPC41163

Ingredient ID: NPC34429

Ingredient ID: NPC310562

Ingredient ID: NPC282974

Ingredient ID: NPC282694

Ingredient ID: NPC274613

Ingredient ID: NPC273326

Ingredient ID: NPC264317

Ingredient ID: NPC254199

Ingredient ID: NPC244705

Ingredient ID: NPC243728

Ingredient ID: NPC242580

Ingredient ID: NPC230920

Ingredient ID: NPC230301

Ingredient ID: NPC22098

Ingredient ID: NPC215242

Ingredient ID: NPC210560

Ingredient ID: NPC194208

Ingredient ID: NPC1940

Ingredient ID: NPC192744

Ingredient ID: NPC181225

Ingredient ID: NPC178134

Ingredient ID: NPC176869

Ingredient ID: NPC171928

Ingredient ID: NPC165651

Ingredient ID: NPC149203

Ingredient ID: NPC143799

Ingredient ID: NPC125575

Ingredient ID: NPC123965

Ingredient ID: NPC123658

Ingredient ID: NPC110899

Ingredient ID: NPC106200

Ingredient ID: NPC101475