• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Solanum Incanum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCACAGCAGAACGACCCGCGAACACGTTCAAACACCGGGGGAGCCGCGCGGCGTGGGCCGCTCCGGCGCCGCCCCGCGCGTCTGCCCCTCGCCCCCCTCTTCGGGGGGGCCAAACGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAACGAGAGCCCTCCGCCCGTGCCCCGTCCGCGGGCCGTGCGGGCGGATGCGTGCTTCTTTCGAAACCAAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGNAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCGCACGCCGCTCGGCGTCGCGGGGGCGGATACTGGCCTCCCGTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAACTCAACTCTCTTGGTGCCGCGGCCACAGCCCGTCGNGCGTGCGCGCTCCACGGCCCCTCCGGCGCTAGCGCGCTCCGACC

Click for details-----ITS1

GGATCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACACGTTCAAACACCGGGGGAGCCGCGCGGCGCGGGCCGCTCCGGCGCCGCCCCGCGCGTCTGCCCCTCGCCCCCCTCTTCGGGGGGGCCAAACGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAACGAGAGCCCTCCGCCCGTGCCCCGTCCGCGGGCCGTGCGGGCGGATGCGTGCTTCTTTCGAAACCAAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO22594
Plant Latin Name: Solanum Incanum
Taxonomy Genus: Solanum
Taxonomy Family: Solanaceae

Plant External Links:

NCBI TaxonomyDB: 329779
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

15 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


4 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

11 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC85001

Ingredient ID: NPC78263

Ingredient ID: NPC51700

Ingredient ID: NPC50539

Ingredient ID: NPC485589

Ingredient ID: NPC485587

Ingredient ID: NPC485586

Ingredient ID: NPC485585

Ingredient ID: NPC264752

Ingredient ID: NPC25455

Ingredient ID: NPC203486

Ingredient ID: NPC197087

Ingredient ID: NPC132787

Ingredient ID: NPC122819

Ingredient ID: NPC109759