• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Paeonia Suffruticosa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCTGCCTAGCAGAACGACCAGCGAACTTGTAAAAATGCTCGGGCTGAGGGAAGGCGTGAGCCTCTCCTTCATCCCACGTCCGATCGCACCAGACGTTGAGTCGCCCCTCGCACGATGTGCAGGGAAGCGCCAAGGTTCTGGTGTGCTCTCGGATTTACAACAAACCCCGGCGCAAACCGCGCCAAGGAACTAAAACGAAAGAGCATGCCCCCGTTGCCCCGACTTTGGGATGCGCGGGAGGTAATGTCTTCTTTTACATATCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAATCACCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCCTTTAGGCTGAGGGCACGTCTGCCTGGGCGTCACGTATCCCGTCGCACCCCCAACCCGTCCCAACGCGGGCACGATGGCTGGTGGGAGCGGATATTGGCCTCCCGTGTACTCGCGTCGCGGTTGGTCTAAAATCGAGCCCCGAGCGACGAACGTCACGACAAGTGGTGGTCTGTAATAGCTATTTCGTGTTGTGCGTTGTCTCGTCGCCCGTGTGAGCTCACAAAAACCCCAGAGCATCGTCACGACGATGCTCCATCGCGACCCCAGGTCAGCAGACCACCGCC

Click for details-----ITS1

TCGAACCTGCCTAGCAGAACGACCAGCGAACTTGTAAAAATGCCCGGGCCGAGGGAAGGCGTGAGCCTCTCCTTCATCCCACGTCCGATCGCACCAGACGTTGAGTCGCCCCTGGCACGATGTGCATGGAAGCGCCAAGGTTCTGGTGTGCCCTCGGATTTACAACAAACCCCGGCGCAAACCGCGCCAAGGAACTAAAACGAAAGAGCATGCCCCCGTTGCCCCGACTTTGGGATGCGCGGGAGGTAATGTCTTCTTTTACATATCAAAA

Click for details-----ITS2

ATCCCGTCGCACCCCCAACCCGTCCCAACGCGGGCACGATGGCTGGTGGGAGCGGATATTGGCCTCCCGTGTACTCGCGTCGCGGTTGGTCTAAAATCGAGCCCCGAGCGACGAACGTCACGACAAGTGGTGGTCTGTAATAGCTATTTCGTGTTGTGCGTTGTCTCGTCGCCCGTGTGAGCTCACAAAAACCCCAGAGCATCGTCACGACGATGCTCCATCGCGACCCCAGGTCAGCAGACCACCGCC
Taxonomic Information

Plant ID: NPO22550
Plant Latin Name: Paeonia Suffruticosa
Taxonomy Genus: Paeonia
Taxonomy Family: Paeoniaceae

Plant External Links:

NCBI TaxonomyDB: 45171
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Korea

Traditional Medicine System:
Kampo


Medicinal Functions:

Analgesic; Antibacterial; Antiinflammatory; Antipyretic; Antispasmodic; Emmenagogue; Sedative; Styptic; Tonic

Geographical Distribution

South Korea

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

121 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


35 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

65 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98365

Ingredient ID: NPC96423

Ingredient ID: NPC88358

Ingredient ID: NPC88176

Ingredient ID: NPC81010

Ingredient ID: NPC80360

Ingredient ID: NPC77493

Ingredient ID: NPC76270

Ingredient ID: NPC73559

Ingredient ID: NPC70744

Ingredient ID: NPC66700

Ingredient ID: NPC64925

Ingredient ID: NPC62765

Ingredient ID: NPC61477

Ingredient ID: NPC52975

Ingredient ID: NPC50898

Ingredient ID: NPC49290

Ingredient ID: NPC477627

Ingredient ID: NPC477623

Ingredient ID: NPC477617

Ingredient ID: NPC47272

Ingredient ID: NPC469519

Ingredient ID: NPC469459

Ingredient ID: NPC469456

Ingredient ID: NPC469448

Ingredient ID: NPC469438

Ingredient ID: NPC469417

Ingredient ID: NPC469415

Ingredient ID: NPC469397

Ingredient ID: NPC469396

Ingredient ID: NPC41744

Ingredient ID: NPC40577

Ingredient ID: NPC34066

Ingredient ID: NPC3357

Ingredient ID: NPC329148

Ingredient ID: NPC322726

Ingredient ID: NPC318826

Ingredient ID: NPC307605

Ingredient ID: NPC303429

Ingredient ID: NPC302857

Ingredient ID: NPC301598

Ingredient ID: NPC29884

Ingredient ID: NPC29883

Ingredient ID: NPC297987

Ingredient ID: NPC297719

Ingredient ID: NPC294282

Ingredient ID: NPC293568

Ingredient ID: NPC293378

Ingredient ID: NPC290690

Ingredient ID: NPC288259

Ingredient ID: NPC285875

Ingredient ID: NPC285184

Ingredient ID: NPC283530

Ingredient ID: NPC280725

Ingredient ID: NPC275088

Ingredient ID: NPC272016

Ingredient ID: NPC265784

Ingredient ID: NPC264145

Ingredient ID: NPC262911

Ingredient ID: NPC262450

Ingredient ID: NPC260005

Ingredient ID: NPC251701

Ingredient ID: NPC250447

Ingredient ID: NPC248540

Ingredient ID: NPC248294

Ingredient ID: NPC247629

Ingredient ID: NPC245506

Ingredient ID: NPC23988

Ingredient ID: NPC233538

Ingredient ID: NPC23253

Ingredient ID: NPC225710

Ingredient ID: NPC219876

Ingredient ID: NPC218685

Ingredient ID: NPC21835

Ingredient ID: NPC213935

Ingredient ID: NPC213723

Ingredient ID: NPC20791

Ingredient ID: NPC204998

Ingredient ID: NPC203124

Ingredient ID: NPC195114

Ingredient ID: NPC192689

Ingredient ID: NPC192402

Ingredient ID: NPC19125

Ingredient ID: NPC19044

Ingredient ID: NPC188217

Ingredient ID: NPC186098

Ingredient ID: NPC183051

Ingredient ID: NPC18197

Ingredient ID: NPC181360

Ingredient ID: NPC179498

Ingredient ID: NPC17733

Ingredient ID: NPC176740

Ingredient ID: NPC176325

Ingredient ID: NPC17150

Ingredient ID: NPC16728

Ingredient ID: NPC16512

Ingredient ID: NPC16388

Ingredient ID: NPC161626

Ingredient ID: NPC160785

Ingredient ID: NPC159200

Ingredient ID: NPC15658

Ingredient ID: NPC154149

Ingredient ID: NPC151516

Ingredient ID: NPC149002

Ingredient ID: NPC148185

Ingredient ID: NPC147722

Ingredient ID: NPC141724

Ingredient ID: NPC141331

Ingredient ID: NPC133430

Ingredient ID: NPC130683

Ingredient ID: NPC130520

Ingredient ID: NPC129588

Ingredient ID: NPC128610

Ingredient ID: NPC120012

Ingredient ID: NPC119900

Ingredient ID: NPC117943

Ingredient ID: NPC116775

Ingredient ID: NPC113212

Ingredient ID: NPC110899

Ingredient ID: NPC104222

Ingredient ID: NPC100551