• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Stephania Dielsiana


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TTGATGCTTGCAAAACGACCCGTGAACCATTGACACCGTAACATTTGCGACGCAGGCGGCCCATCGGGTCCTTGTTGTTCAGCAACAAAATCCGGCGCGACATGCGCCAAGGAATCTAAATTAGAATAGAAACGACACGTTGAAGTGGTTCGTCCACTTCATTGTGTTGCGTTTCTGAATACTTGAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO22500
Plant Latin Name: Stephania Dielsiana
Taxonomy Genus: Stephania
Taxonomy Family: Menispermaceae

Plant External Links:

NCBI TaxonomyDB: 1501458
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

37 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


24 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

23 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98702

Ingredient ID: NPC95090

Ingredient ID: NPC72452

Ingredient ID: NPC70853

Ingredient ID: NPC6908

Ingredient ID: NPC65197

Ingredient ID: NPC61546

Ingredient ID: NPC40379

Ingredient ID: NPC39633

Ingredient ID: NPC310259

Ingredient ID: NPC295580

Ingredient ID: NPC294815

Ingredient ID: NPC29353

Ingredient ID: NPC278556

Ingredient ID: NPC275625

Ingredient ID: NPC272958

Ingredient ID: NPC270620

Ingredient ID: NPC262094

Ingredient ID: NPC255840

Ingredient ID: NPC254133

Ingredient ID: NPC236769

Ingredient ID: NPC234133

Ingredient ID: NPC232302

Ingredient ID: NPC231410

Ingredient ID: NPC206102

Ingredient ID: NPC195202

Ingredient ID: NPC188646

Ingredient ID: NPC179726

Ingredient ID: NPC176740

Ingredient ID: NPC156461

Ingredient ID: NPC150648

Ingredient ID: NPC143190

Ingredient ID: NPC127447

Ingredient ID: NPC120320

Ingredient ID: NPC10781

Ingredient ID: NPC103904

Ingredient ID: NPC101294