• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Gastrodia Elata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAGATCGAAAGAGCATTTTGAGCGATTCAGATAACTCGTGAACTGCAGCGGCTCGTCTGGCGCCAACACGCAGCAGCAGCTCGAGCCGGCGCCCCCCTCCAGGGGGCTACGGCGCGGGTCGGTTGAACTCAAACAAGTGCAGCGCCGTGCCAAAGGAACACGTTTGTGCAGGATCCCGCGAGCGGGCTTCATGACGTGGGCGTCGTTGCGCTCCGAAAGGACTAGCACAACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGTGCAGCGAAATGCGATACGTGGTGCGAATTGCAAAATCCTGCGAACCATCGAGTCTTTGAACGCAAATTGCGCCCGAGGCCAATTGGCCAAGGGAACGCCCGCCTGGACGTCAAGCATTATCCCCACTCGGCGCCCAAGCGCACGTCGCCGGCACGAACACGCAGACTAGCTCCTCGTATTCGCTGGCGCGGCAGACTGAAGTGCGAGTTGCACCGCTCCCGCTGTGGTCGTGACCTACAAGGGTGGAAGGAAACGTTGTGTGCCTCAGATATTTGTCTCGCGTCGCGGCCCACGGGGCGTCTTGCGCTCTCGATATTTCAAAATCCCCTGCACCGCAAGCCCGTGGTGACTAGGA

Click for details-----ITS1

TCGAGATCGAAAGAGCATTTTGAGCGATTCAGATAACTCGTGAACTGCAGCGGCTCGTCTGGCGCCAACACGCAGCAGCAGCTCGAGCCGGCGCCCCCCTCCAGGGGGCTACGGCGCGGGTCGGTTGAACTCAAACAAGTGCAGCGCCGTGCCAAAGGAACACGTTTGTGCAGGATCCCGCGAGCGGGCTTCATGACGTGGGCGTCGTTGCGCTCCGAAAGGACTAGCA

Click for details-----ITS2

ATTATCCCCACTCGGCGCCCAAGCGCACGTCGCCGGCACGAACACGCAGACTAGCTCCTCGTATTCGCTGGCGCGGCAGACTGAAGTGCGAGTTGCACCGCTCCCGCTGTGGTCGTGACCTACAAGGGTGGAAGGAAACGTTGTGTGCCTCAGATATTTGTCTCGCGTCGCGGCCCACGGGGCGTCTTGCGCTCTCGATATTTCAAAATCCCCTGCACCGCAAGCCCGTGGTGACTAGGA
Taxonomic Information

Plant ID: NPO22309
Plant Latin Name: Gastrodia Elata
Taxonomy Genus: Gastrodia
Taxonomy Family: Orchidaceae

Plant External Links:

NCBI TaxonomyDB: 91201
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Korea; China

Traditional Medicine System:
TCM; Kampo


Medicinal Functions:

Analgesic; Antispasmodic; Aphrodisiac; Carminative; Cholagogue; Sedative; Tonic

Geographical Distribution

South Korea; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

102 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


62 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

46 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9812

Ingredient ID: NPC94366

Ingredient ID: NPC87118

Ingredient ID: NPC82948

Ingredient ID: NPC76639

Ingredient ID: NPC7617

Ingredient ID: NPC72004

Ingredient ID: NPC70756

Ingredient ID: NPC67644

Ingredient ID: NPC66700

Ingredient ID: NPC66655

Ingredient ID: NPC66628

Ingredient ID: NPC66110

Ingredient ID: NPC62670

Ingredient ID: NPC61198

Ingredient ID: NPC60523

Ingredient ID: NPC60350

Ingredient ID: NPC56610

Ingredient ID: NPC49976

Ingredient ID: NPC47834

Ingredient ID: NPC45040

Ingredient ID: NPC43246

Ingredient ID: NPC41484

Ingredient ID: NPC329546

Ingredient ID: NPC323787

Ingredient ID: NPC323434

Ingredient ID: NPC309190

Ingredient ID: NPC305205

Ingredient ID: NPC302001

Ingredient ID: NPC300478

Ingredient ID: NPC299710

Ingredient ID: NPC29883

Ingredient ID: NPC297658

Ingredient ID: NPC29601

Ingredient ID: NPC293619

Ingredient ID: NPC293378

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC289758

Ingredient ID: NPC285445

Ingredient ID: NPC284039

Ingredient ID: NPC278102

Ingredient ID: NPC27699

Ingredient ID: NPC275104

Ingredient ID: NPC274689

Ingredient ID: NPC27176

Ingredient ID: NPC269242

Ingredient ID: NPC257885

Ingredient ID: NPC250178

Ingredient ID: NPC249045

Ingredient ID: NPC248962

Ingredient ID: NPC244411

Ingredient ID: NPC243728

Ingredient ID: NPC242419

Ingredient ID: NPC241737

Ingredient ID: NPC241258

Ingredient ID: NPC236709

Ingredient ID: NPC230301

Ingredient ID: NPC224995

Ingredient ID: NPC224792

Ingredient ID: NPC224243

Ingredient ID: NPC22098

Ingredient ID: NPC220089

Ingredient ID: NPC219913

Ingredient ID: NPC216714

Ingredient ID: NPC216630

Ingredient ID: NPC213935

Ingredient ID: NPC212436

Ingredient ID: NPC207940

Ingredient ID: NPC207246

Ingredient ID: NPC206079

Ingredient ID: NPC205941

Ingredient ID: NPC203719

Ingredient ID: NPC194198

Ingredient ID: NPC187911

Ingredient ID: NPC187011

Ingredient ID: NPC186653

Ingredient ID: NPC18335

Ingredient ID: NPC180346

Ingredient ID: NPC180058

Ingredient ID: NPC172439

Ingredient ID: NPC169749

Ingredient ID: NPC16728

Ingredient ID: NPC163105

Ingredient ID: NPC157519

Ingredient ID: NPC156461

Ingredient ID: NPC150962

Ingredient ID: NPC142753

Ingredient ID: NPC13710

Ingredient ID: NPC135716

Ingredient ID: NPC133544

Ingredient ID: NPC130683

Ingredient ID: NPC124513

Ingredient ID: NPC121395

Ingredient ID: NPC117129

Ingredient ID: NPC116139

Ingredient ID: NPC113610

Ingredient ID: NPC111897

Ingredient ID: NPC111888

Ingredient ID: NPC108908

Ingredient ID: NPC106484

Ingredient ID: NPC10437