• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Rhaponticum Carthamoides


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGMAGCCTGCACAGCAGAACGACCCGTGAACATGTAATCACAATCRGGTGTCGTGGGATCGGGTGTGAGCCCTAGTCCTGCGATGCTCGYCGGCATGCRTCCAAGGTGCCTATCTTTAGGCATNGTCGATGTTTTGTCGGCACAAAAACAAACCCCGGCACGGCATGTGCCAAGGAAAACAAAACTTAAGAAGGGTGCGTCTCGTGTTGTCCCGTTTTCGGTRTGCACACGGGTCGTGGCCTCTCATTAACCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCAGACCACGCTCCCCCATGGGGATRTGTTTTGTCTGGGACGGAGACTGGTCTCCCGTGCCGACGGYGCGGTTGGCCTAAAAAGGAGTCCCCTTTGGCGGGCGCACGGCTAGTGGTGGTTGTCAAGGCCTTCGTATCGAGCCGTGTTGATGCAAGGGATTCGCTCTYTTAAGACCCTAAYGTGTCGTCTTACGACGATGCTTCGACCGCGACCCCAGGTCAGGCGGGACT

Click for details-----ITS1

TCGMAGCCTGCACAGCAGAACGACCCGTGAACATGTAATCACAATCRGGTGTCGTGGGATCGGGTGTGAGCCCTAGTCCTGCGATGCTCGYCGGCATGCRTCCAAGGTGCCTATCTTTAGGCATNGTCGATGTTTTGTCGGCACAAAAACAAACCCCGGCACGGCATGTGCCAAGGAAAACAAAACTTAAGAAGGGTGCGTCTCGTGTTGTCCCGTTTTCGGTRTGCACACGGGTCGTGGCCTCTCATTAACCATAAA

Click for details-----ITS2

ATCGCGTCGCCCCAGACCACGCTCCCCCATGGGGATRTGTTTTGTCTGGGACGGAGACTGGTCTCCCGTGCCGACGGYGCGGTTGGCCTAAAAAGGAGTCCCCTTTGGCGGGCGCACGGCTAGTGGTGGTTGTCAAGGCCTTCGTATCGAGCCGTGTTGATGCAAGGGATTCGCTCTYTTAAGACCCTAAYGTGTCGTCTTACGACGATGCTTCGACCGCGACCCCAGGTCAGGCGGGACT
Taxonomic Information

Plant ID: NPO223
Plant Latin Name: Rhaponticum Carthamoides
Taxonomy Genus: Rhaponticum
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 362630
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; Russia

Traditional Medicine System:
TCM

Geographical Distribution

China; Russia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

159 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


91 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

54 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC99965

Ingredient ID: NPC97210

Ingredient ID: NPC96102

Ingredient ID: NPC94237

Ingredient ID: NPC9112

Ingredient ID: NPC89842

Ingredient ID: NPC89657

Ingredient ID: NPC87706

Ingredient ID: NPC83284

Ingredient ID: NPC79298

Ingredient ID: NPC78437

Ingredient ID: NPC78093

Ingredient ID: NPC75389

Ingredient ID: NPC75052

Ingredient ID: NPC74258

Ingredient ID: NPC73631

Ingredient ID: NPC73300

Ingredient ID: NPC73050

Ingredient ID: NPC64506

Ingredient ID: NPC6193

Ingredient ID: NPC61236

Ingredient ID: NPC60653

Ingredient ID: NPC59006

Ingredient ID: NPC54965

Ingredient ID: NPC50898

Ingredient ID: NPC48899

Ingredient ID: NPC477848

Ingredient ID: NPC45173

Ingredient ID: NPC44295

Ingredient ID: NPC43063

Ingredient ID: NPC3930

Ingredient ID: NPC38772

Ingredient ID: NPC3452

Ingredient ID: NPC32771

Ingredient ID: NPC326714

Ingredient ID: NPC321796

Ingredient ID: NPC313186

Ingredient ID: NPC313054

Ingredient ID: NPC312481

Ingredient ID: NPC311506

Ingredient ID: NPC311047

Ingredient ID: NPC305001

Ingredient ID: NPC304309

Ingredient ID: NPC304276

Ingredient ID: NPC303822

Ingredient ID: NPC299654

Ingredient ID: NPC298278

Ingredient ID: NPC297101

Ingredient ID: NPC295843

Ingredient ID: NPC287433

Ingredient ID: NPC286799

Ingredient ID: NPC28657

Ingredient ID: NPC28198

Ingredient ID: NPC281547

Ingredient ID: NPC281016

Ingredient ID: NPC280447

Ingredient ID: NPC280371

Ingredient ID: NPC280224

Ingredient ID: NPC279989

Ingredient ID: NPC279591

Ingredient ID: NPC278681

Ingredient ID: NPC278214

Ingredient ID: NPC275060

Ingredient ID: NPC273469

Ingredient ID: NPC270768

Ingredient ID: NPC268826

Ingredient ID: NPC267759

Ingredient ID: NPC26697

Ingredient ID: NPC259817

Ingredient ID: NPC259264

Ingredient ID: NPC256645

Ingredient ID: NPC254190

Ingredient ID: NPC253208

Ingredient ID: NPC25012

Ingredient ID: NPC247852

Ingredient ID: NPC239511

Ingredient ID: NPC236347

Ingredient ID: NPC235413

Ingredient ID: NPC234392

Ingredient ID: NPC233478

Ingredient ID: NPC232564

Ingredient ID: NPC232533

Ingredient ID: NPC230301

Ingredient ID: NPC228293

Ingredient ID: NPC226575

Ingredient ID: NPC225609

Ingredient ID: NPC224553

Ingredient ID: NPC221953

Ingredient ID: NPC220765

Ingredient ID: NPC217440

Ingredient ID: NPC216531

Ingredient ID: NPC216392

Ingredient ID: NPC215696

Ingredient ID: NPC213956

Ingredient ID: NPC213761

Ingredient ID: NPC20620

Ingredient ID: NPC204717

Ingredient ID: NPC204050

Ingredient ID: NPC200361

Ingredient ID: NPC193295

Ingredient ID: NPC192977

Ingredient ID: NPC192901

Ingredient ID: NPC190537

Ingredient ID: NPC190229

Ingredient ID: NPC189863

Ingredient ID: NPC188463

Ingredient ID: NPC186544

Ingredient ID: NPC185287

Ingredient ID: NPC184586

Ingredient ID: NPC184555

Ingredient ID: NPC184101

Ingredient ID: NPC181943

Ingredient ID: NPC18188

Ingredient ID: NPC180792

Ingredient ID: NPC171171

Ingredient ID: NPC171126

Ingredient ID: NPC171014

Ingredient ID: NPC170801

Ingredient ID: NPC166763

Ingredient ID: NPC166002

Ingredient ID: NPC16270

Ingredient ID: NPC162379

Ingredient ID: NPC161252

Ingredient ID: NPC158092

Ingredient ID: NPC157694

Ingredient ID: NPC157380

Ingredient ID: NPC157154

Ingredient ID: NPC156704

Ingredient ID: NPC155182

Ingredient ID: NPC153589

Ingredient ID: NPC150228

Ingredient ID: NPC149785

Ingredient ID: NPC149683

Ingredient ID: NPC148473

Ingredient ID: NPC14811

Ingredient ID: NPC146786

Ingredient ID: NPC146221

Ingredient ID: NPC143676

Ingredient ID: NPC142927

Ingredient ID: NPC142397

Ingredient ID: NPC139459

Ingredient ID: NPC138897

Ingredient ID: NPC137462

Ingredient ID: NPC1359

Ingredient ID: NPC13326

Ingredient ID: NPC131593

Ingredient ID: NPC127581

Ingredient ID: NPC126870

Ingredient ID: NPC124275

Ingredient ID: NPC120926

Ingredient ID: NPC113425

Ingredient ID: NPC112936

Ingredient ID: NPC112776

Ingredient ID: NPC11105

Ingredient ID: NPC108721

Ingredient ID: NPC107217

Ingredient ID: NPC103491

Ingredient ID: NPC103007

Ingredient ID: NPC100596

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Therapeutic Target 5HT3 receptor HTR3A Serotonin 3a (5-HT3a) receptor P46098 CHEMBL1899
Cytochrome P450 Cytochrome P450 family 1 CYP1A2 Cytochrome P450 1A2 P05177 CHEMBL3356
Cytochrome P450 Cytochrome P450 family 1 CYP1B1 Cytochrome P450 1B1 Q16678 CHEMBL4878
Cytochrome P450 Cytochrome P450 family 1 CYP1A1 Cytochrome P450 1A1 P04798 CHEMBL2231
Therapeutic Target Enzyme BLM Bloom syndrome protein P54132 CHEMBL1293237
Therapeutic Target GABA-A receptor GABRR1 GABA receptor rho-1 subunit P24046 CHEMBL3561
Therapeutic Target Hydrolase ACHE Acetylcholinesterase P22303 CHEMBL220
Therapeutic Target Nuclear hormone receptor subfamily 1 RORC Nuclear receptor ROR-gamma P51449 CHEMBL1741186
Therapeutic Target Nuclear hormone receptor subfamily 3 ESR2 Estrogen receptor beta Q92731 CHEMBL242
Therapeutic Target Oxidoreductase HSD17B1 Estradiol 17-beta-dehydrogenase 1 P14061 CHEMBL3181
Therapeutic Target Oxidoreductase MPO Myeloperoxidase P05164 CHEMBL2439
Therapeutic Target Oxidoreductase HSD17B10 Endoplasmic reticulum-associated amyloid beta-peptide-binding protein Q99714 CHEMBL4159
Therapeutic Target Peptide receptor (family A GPCR) OPRD1 Delta opioid receptor P41143 CHEMBL236
Therapeutic Target Peptide receptor (family A GPCR) OPRM1 Mu opioid receptor P35372 CHEMBL233
Therapeutic Target Protein Kinase CSNK2A1 Casein kinase II alpha P68400 CHEMBL3629
Therapeutic Target Protein Kinase MKNK2 MAP kinase signal-integrating kinase 2 Q9HBH9 CHEMBL4204
Therapeutic Target Protein methyltransferase KMT2A Histone-lysine N-methyltransferase MLL Q03164 CHEMBL1293299
Therapeutic Target Secreted protein THPO Thrombopoietin P40225 CHEMBL1293256
Therapeutic Target Secreted protein TTR Transthyretin P02766 CHEMBL3194
Therapeutic Target Serine protease DPP4 Dipeptidyl peptidase IV P27487 CHEMBL284
Drug Transporter SLC superfamily of solute carriers SLCO1B3 Solute carrier organic anion transporter family member 1B3 Q9NPD5 CHEMBL1743121
Therapeutic Target Small molecule receptor (family A GPCR) HTR2B Serotonin 2b (5-HT2b) receptor P41595 CHEMBL1833
Therapeutic Target Small molecule receptor (family A GPCR) HTR2C Serotonin 2c (5-HT2c) receptor P28335 CHEMBL225
Therapeutic Target Small molecule receptor (family A GPCR) HTR6 Serotonin 6 (5-HT6) receptor P50406 CHEMBL3371
Therapeutic Target Small molecule receptor (family A GPCR) HTR1F Serotonin 1f (5-HT1f) receptor P30939 CHEMBL1805
Therapeutic Target Small molecule receptor (family A GPCR) ADRA1D Alpha-1d adrenergic receptor P25100 CHEMBL223
Therapeutic Target Small molecule receptor (family A GPCR) ADRB1 Beta-1 adrenergic receptor P08588 CHEMBL213
Therapeutic Target Small molecule receptor (family A GPCR) ADRB2 Beta-2 adrenergic receptor P07550 CHEMBL210
Therapeutic Target Small molecule receptor (family A GPCR) HTR2A Serotonin 2a (5-HT2a) receptor P28223 CHEMBL224
Therapeutic Target Small molecule receptor (family A GPCR) DRD2 Dopamine D2 receptor P14416 CHEMBL217
Therapeutic Target Small molecule receptor (family A GPCR) ADRA1B Alpha-1b adrenergic receptor P35368 CHEMBL232
Therapeutic Target Small molecule receptor (family A GPCR) ADRA1A Alpha-1a adrenergic receptor P35348 CHEMBL229
Therapeutic Target Small molecule receptor (family A GPCR) ADRA2B Alpha-2b adrenergic receptor P18089 CHEMBL1942
Therapeutic Target Small molecule receptor (family A GPCR) HTR1E Serotonin 1e (5-HT1e) receptor P28566 CHEMBL2182
Therapeutic Target Small molecule receptor (family A GPCR) ADRB3 Beta-3 adrenergic receptor P13945 CHEMBL246
Therapeutic Target Small molecule receptor (family A GPCR) ADRA2A Alpha-2a adrenergic receptor P08913 CHEMBL1867
Therapeutic Target Small molecule receptor (family A GPCR) HTR1A Serotonin 1a (5-HT1a) receptor P08908 CHEMBL214
Therapeutic Target Small molecule receptor (family A GPCR) DRD3 Dopamine D3 receptor P35462 CHEMBL234
Therapeutic Target Small molecule receptor (family A GPCR) HTR5A Serotonin 5a (5-HT5a) receptor P47898 CHEMBL3426
Therapeutic Target Small molecule receptor (family A GPCR) HTR7 Serotonin 7 (5-HT7) receptor P34969 CHEMBL3155
Therapeutic Target Small molecule receptor (family A GPCR) HTR1D Serotonin 1d (5-HT1d) receptor P28221 CHEMBL1983
Therapeutic Target Small molecule receptor (family A GPCR) HTR4 Serotonin 4 (5-HT4) receptor Q13639 CHEMBL1875
Therapeutic Target Small molecule receptor (family A GPCR) HTR1B Serotonin 1b (5-HT1b) receptor P28222 CHEMBL1898
Therapeutic Target Surface antigen F3 Coagulation factor III P13726 CHEMBL4081
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level334
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT01906762 Comparing the Analgesic Effect of Intravenous Acetaminophen and Morphine on Patients With Renal Colic Pain Reffering to the Emergency Department: A Randomized Controlled Trial Renal Colic Morphine (NPC232533) NP level
NCT02115087 Efficacy Study of Rectus Sheath Block to Control Postoperative Pain pain Morphine (NPC232533) NP level
NCT03933397 Comparing Individualized vs. Weight Based Protocols to Treat VOE in SCD Occlusive Episodes in Sickle Cell Disease sickle cell anemia Morphine (NPC232533) NP level
NCT01830296 Intravenous Remifentanil Plus Morphine or Morphine Alone for Postthoracotomy Pain pain Morphine (NPC232533) NP level
NCT02781415 Acupuncture Versus Titrated Morphine in Patients With Renal Colic Renal Colic Morphine (NPC232533) NP level
NCT02044302 A Prospective Trial to Reduce Post-Operative Pain in Implant Based Breast Reconstruction pain Morphine (NPC232533) NP level
NCT03007121 Intrathecal Morphine Analgesia vs. Continuous Epidural Analgesia vs. Systemic Analgesia in Colorectal Surgery. pain Morphine (NPC232533) NP level
NCT02300194 Randomized, Double-blind, Placebo, Controlled Cross Over Design Topical Morphine for Analgesia in Pediatric Procedures pain Morphine (NPC232533) NP level
NCT03549221 Efficacy of Adrenaline in Periarticular Analgesic Injection on Postoperative Pain Control After Total Knee Arthroplasty pain Epinephrine (NPC236347) NP level
NCT05281081 Intraperitoneal Instillation of Levobupivacaine With Morphine Versus Levobupivacaine With Magnesium Sulfate for Postoperative Analgesia pain Morphine (NPC232533) NP level
NCT01691690 Analgesic Effect of IV Acetaminophen in Tonsillectomies Recurrent tonsillitis Morphine (NPC232533) NP level
NCT00134212 Dopexamine and Norepinephrine Compared With Epinephrine Alone in Septic Shock septic shock Epinephrine (NPC236347) NP level
NCT03036384 Estimation of the ED95 of Intrathecal Hyperbaric Prilocaine 2% With Sufentanyl for Scheduled Cesarean Delivery pregnancy Morphine (NPC232533) NP level
NCT03098420 Dose Escalation of Dexamethasone to Increase Duration of Transversus Abdominal Plane Block Following Cesarean Section pain Morphine (NPC232533) NP level
NCT04527393 Individualized Analgesia for Pediatric Adenotonsillectomy pain Morphine (NPC232533) NP level
NCT00872885 Bunionectomy Trial With GRT6005 pain Morphine (NPC232533) NP level
NCT00729794 Vasopressin, Epinephrine, and Steroids for Cardiac Arrest cardiac arrest Epinephrine (NPC236347) NP level
NCT01794533 Effect of Fentanyl on the Rate of Anesthesia pulpitis Epinephrine (NPC236347) NP level
NCT02111746 PAIN - Postoperative Analgesia INvestigation pain Morphine (NPC232533) NP level
NCT03567473 Bronchiolitis in Infants Placebo Versus Epinephrine and Dexamethasone Study Bronchiolitis Epinephrine (NPC236347) NP level
NCT00528177 Morphine vs. Oxycodone for Postoperative Pain Management pain Morphine (NPC232533) NP level
NCT01825993 RANDOMISED STUDY OF EPIDURAL VS MPCA MORPHINE VS TAPP IN LAPAROSCOPIC SIGMOIDECTOMY neoplasm Morphine (NPC232533) NP level
NCT00460239 Buprenorphine's Dose Response Curve opioid dependence Morphine (NPC232533) NP level
NCT01186445 Morphine In Acute Myocardial Infarction acute myocardial infarction Morphine (NPC232533) NP level
NCT03288428 Analgesia Comparison of Nalbuphine and Morphine for Laparoscopic Myomectomy pain Morphine (NPC232533) NP level
NCT05327556 Epinephrine in the Pediatric Intensive Care Unit: A Dose-Effect Trial hypotension Epinephrine (NPC236347) NP level
NCT00237731 Pre-hospital Morphine Titration : Comparison of 0,05 Versus 0,1 mg/kg pain Morphine (NPC232533) NP level
NCT01782781 Local Infiltration Analgesia After Abdominal Hysterectomy pain Epinephrine (NPC236347) NP level
NCT04852003 A Trial of SHR0410 Injection for the Treatment of Pain After Endoscopic Surgery of the Lower Abdominal pain Morphine (NPC232533) NP level
NCT00383682 Efficacy of Opioids and Mexiletine for the Treatment of Postamputation Pain Chronic pain Morphine (NPC232533) NP level
NCT03825887 Nalbuphine Versus Morphine for Mucositis Pain in Pediatric Cancer Patients acute myeloid leukemia Morphine (NPC232533) NP level
NCT02568995 Pain Management Following Total Hip Arthroplasty pain Epinephrine (NPC236347) NP level
NCT02014714 Single Dose Morphine and Fentanyl Added to Intrathecal Mixture on Orthopedics Patients With Undiagnosed Obstructive Sleep Apnea obstructive sleep apnea Morphine (NPC232533) NP level
NCT04911062 HTX-011 in Spinal Surgery pain Epinephrine (NPC236347) NP level
NCT01951963 Sub-dissociative Ketamine for the Management of Acute Pediatric Pain pain Morphine (NPC232533) NP level
NCT03843281 Efficacy of Paracetamol in Addition to Morphine to Improve Analgesia in the Emergency Department pain Morphine (NPC232533) NP level
NCT03678792 Comparison of Three Opioid Detoxification Treatment Regimens opioid dependence Morphine (NPC232533) NP level
NCT00362219 Topical Morphine for Analgesia in Patients With Skin Grafts pain Morphine (NPC232533) NP level
NCT03015246 Effects of Buprenorphine/Naloxone Dose on Experimental Stress Reactivity and Opioid Abstinence heroin dependence;opioid use disorder Morphine (NPC232533) NP level
NCT02976597 Ultrasound Guided TAP Block for Postoperative Analgesia After Abdominal Surgery. pain Morphine (NPC232533) NP level
NCT01737892 Assessment and Evaluation of Pharmacokinetic Profile of E004 in Healthy Adults asthma Epinephrine (NPC236347) NP level
NCT03068260 Ultrasound-guided Transmuscular Quadratus Lumborum Block for Elective Caesarean Section. pain Morphine (NPC232533) NP level
NCT02152514 RCT Comparing Analgesia Post-VATS With Epimorph VS Placebo pain Morphine (NPC232533) NP level
NCT03730714 Surgicel and Analgesic Reservoir pain Morphine (NPC232533) NP level
NCT02410317 Ropivacaine Through Continuous Infusion Versus Epidural Morphine for Postoperative Analgesia After Emergency Cesarean Section pain Morphine (NPC232533) NP level
NCT05166343 POHCA Resuscitation: Evaluation of IM Epinephrine cardiac arrest Epinephrine (NPC236347) NP level
NCT01914042 Prediction of Inter-individual Differences in the Response to Morphine Versus Milnacipran in Patients With Sciatica neuropathic pain Morphine (NPC232533) NP level
NCT01737905 Evaluation of Efficacy and Safety for Single Dose of E004 in Children With Asthma asthma Epinephrine (NPC236347) NP level
NCT00558870 Role of Methadone As Co-Opioid Analgesic pain Morphine (NPC232533) NP level
NCT00766506 An Efficacy and Safety Study to Compare Fentanyl Ionsys and Routine Care With Intravenous (IV) Morphine Patient-controlled Analgesia (PCA) in Participants Who Have Undergone Elective Major Abdominal or Orthopedic Surgery pain Morphine (NPC232533) NP level
NCT03254459 Study of Buprenorphine Sublingual Spray Versus Standard of Care Narcotic Therapy for the Treatment of Post-Operative Pain pain Morphine (NPC232533) NP level
NCT02353754 Evaluation of the Safety and Efficacy of EXPAREL When Administered Into the TAP in Subjects Undergoing Cesarean Section pain Morphine (NPC232533) NP level
NCT05037539 Efficacy of Injectable Fentanyl in Sublingual Route Versus Oral Morphine Syrup for Breakthrough Pain pain Morphine (NPC232533) NP level
NCT02511483 Genetic Predictors of Analgesic Efficacy of Propranolol for Treating Postoperative Pain pain Morphine (NPC232533) NP level
NCT02523846 Patient Re-education vs. Background Morphine to IV-PCA in Patient With Unsatisfactory Analgesia Post Laparotomy pain Morphine (NPC232533) NP level
NCT02740127 Evaluate Use of Caudal Nerve Blocks in Adult Penile Prosthesis male reproductive organ cancer Epinephrine (NPC236347) NP level
NCT02912195 Intravenous Lidocaine Versus Morphine for Severe Pain in the ED pain Morphine (NPC232533) NP level
NCT02223533 Multimodal Analgesia With Interfascial Continuous Wound Infiltration: A Randomized Clinical Trial pain Morphine (NPC232533) NP level
NCT01837446 Morphine Mouthwash for Management of Oral Mucositis in Patients With Head and Neck Cancer stomatitis Morphine (NPC232533) NP level
NCT02848599 The Influence of Postoperative Analgesia on Systemic Inflammatory Response and POCD After Femoral Fractures Surgery post-operative sign or symptom Morphine (NPC232533) NP level
NCT00982891 Palliation of Dyspnea in Advanced Chronic Obstructive Pulmonary Disease (COPD) chronic obstructive pulmonary disease Morphine (NPC232533) NP level
NCT00298571 Cesarean Delivery and Post-operative Pain Management With Local Anesthesia pain Epinephrine (NPC236347) NP level
NCT05324995 Peri-Articular-Multimodal Drug and Oral Celecoxib in Management of Postoperative Pain of Total Knee Arthroplasty pain Epinephrine (NPC236347) NP level
NCT01705964 Intramuscular Epinephrine as an Adjunctive Treatment for Severe Pediatric Asthma Exacerbation asthma Epinephrine (NPC236347) NP level
NCT03095222 Exploring the Safety and Efficacy of Low-dose Ketamine Infusions for Pain Control in Acute Burn Injury pain Morphine (NPC232533) NP level
NCT03473093 Oral Pregabalin Effect to the Intravenous Morphine in Multiple Fracture Ribs bone fracture Morphine (NPC232533) NP level
NCT04887649 Randomized, Controlled, Double Blind, to Evaluate the Postpartum Analgesia With Epidural Morphine: Analgesic Effect of Two Different Doses Compared to Placebo pain Morphine (NPC232533) NP level
NCT01245244 Morphine Modulation of The Brain's Pain Matrix pain Morphine (NPC232533) NP level
NCT03607916 Estimation of the Effective Dose (ED) 95 of Intrathecal Hyperbaric Prilocaine 2% for Scheduled Cesarean Delivery. pregnancy Morphine (NPC232533) NP level
NCT02852382 The Effects of Scalp Block on Haemodynamic Response and Postoperative Pain in Posterior Fossa Surgery neoplasm Morphine (NPC232533) NP level
NCT01123551 Efficacy Study of Nebulized Morphine and Intravenous Morphine in Post Traumatic Pain injury Morphine (NPC232533) NP level
NCT02083315 Pharmacokinetics and Pharmacodynamics of TRV130, Morphine, and Placebo in Healthy Subjects pain Morphine (NPC232533) NP level
NCT00201539 Double Bedtime Dosing During Immediate-release Morphine Administration to Cancer Patients cancer Morphine (NPC232533) NP level
NCT03865147 Single-centre Study to Investigate Safety and Efficacy of Tri-Solfen in Wound Debridement injury Epinephrine (NPC236347) NP level
NCT01700192 Efficacy and Safety Study of SCH 900237/MK-8237 in Children and Adults With House Dust Mite-Induced Allergic Rhinitis/Rhinoconjunctivitis (P05607) Rhinitis, Allergic, Perennial Epinephrine (NPC236347) NP level
NCT03011333 Phase 2B Upper Extremity Nerve Block Study pain Epinephrine (NPC236347) NP level
NCT03012971 Dexmedetomidine Supplemented Analgesia and Long-term Survival After Cancer Surgery pain Morphine (NPC232533) NP level
NCT05338320 Postoperative Analgesia in Patients Undergoing Elective Lumbar Fusion Operations Under General Anesthesia pain Morphine (NPC232533) NP level
NCT02673372 Geriatric Ketamine for Pain Management Study pain Morphine (NPC232533) NP level
NCT04061330 Comparison of Low-dose Ketamine to Opioids in the Management of Acute Pain in Patients Presenting to the Emergency Department With Long Bone Fractures pain Morphine (NPC232533) NP level
NCT04551703 Adrenaline Solution Irrigation and Bleeding During Sinus Surgery sinusitis Epinephrine (NPC236347) NP level
NCT05187520 Naldebain for Control of Post-Cesarean Section Pain Chronic pain Morphine (NPC232533) NP level
NCT05355597 "The Efficacy of Exparel Versus a Multidrug Cocktail in Soft Tissue Tumors" musculoskeletal system disease Epinephrine (NPC236347) NP level
NCT01084161 Study to Evaluate the Efficacy, Safety and Tolerability of N1539 pain Morphine (NPC232533) NP level
NCT00266539 A Comparison of the Safety and Effectiveness of Two Forms of Patient-controlled Pain Medication Used After Scheduled Abdominal or Pelvic Surgery: The Fentanyl Transdermal System Versus the Morphine Intravenous Pump pain Morphine (NPC232533) NP level
NCT02726828 intrathecaم Ketamine, Morphine and Both for Lower Abdominal Cancer Surgery Pain pain Morphine (NPC232533) NP level
NCT03511833 Comparison of Treatment by IN Ketamine to IV Morphine in Acute Pain injury Morphine (NPC232533) NP level
NCT03025594 Gonyautoxins Local Periarticular Injection for Pain Management After Total Knee Arthroplasty pain Epinephrine (NPC236347) NP level
NCT01460511 Evaluation of Efficacy and Safety of E004 in Children With Asthma asthma Epinephrine (NPC236347) NP level
NCT00446017 The Effects of Adrenaline and Milrinone in Patients With Myocardial Dysfunction After CABG heart failure Epinephrine (NPC236347) NP level
NCT01077752 Local Anesthetic Continuous Preperitoneal Infiltration and Wound Hyperalgesia pain Morphine (NPC232533) NP level
NCT01979354 0.15 mg Spinal Morphine vs. no Treatment for Morphine Requirement After VATs. pain Morphine (NPC232533) NP level
NCT03035578 Development of a Morphine Pharmacokinetic and Pharmacodynamic Model for the Neonatal Population pain Morphine (NPC232533) NP level
NCT03268278 Efficacy of Buprenorphine on Postoperative Endodontic Analgesia pain Epinephrine (NPC236347) NP level
NCT04221165 Opioid Therapy vs Multimodal Analgesia in Head and Neck Cancer head and neck malignant neoplasia Morphine (NPC232533) NP level
NCT01866254 Use of Intrathecal Hydromorphone in Elective Cesarean Deliveries pain Morphine (NPC232533) NP level
NCT01807429 Is Analgesic Effect of Low Dose Ketamine-midazolam the Same as Morphine multiple bone fractures Morphine (NPC232533) NP level
NCT05325164 Methadone for 'Adenocarcinopathic' Pain Treatment adenocarcinoma Morphine (NPC232533) NP level
NCT03774836 Tramadol Versus Placebo and Morphine in the Management of Post-Operative Pain Abdominoplasty pain Morphine (NPC232533) NP level
NCT03579446 Levorphanol as a Second Line Opioid in Reducing Pain in Patients With Cancer pain Morphine (NPC232533) NP level
NCT01718496 Morphine, Dyspnea, Exercise and COPD chronic obstructive pulmonary disease Morphine (NPC232533) NP level
NCT00609466 A Trial to Evaluate CG5503 Efficacy and Safety in Acute Pain After Bunionectomy pain Morphine (NPC232533) NP level
NCT03120403 Safety and Efficacy of Intrathecal Morphine in Children cancer Morphine (NPC232533) NP level
NCT01539538 A Multicenter, Randomized, Open-Label, Parallel-Group Trial to Compare the Efficacy and Safety of the Sufentanil NanoTab PCA System/15 mcg (Zalviso™)to Intravenous Patient-Controlled Analgesia With Morphine for the Treatment of Acute Post-Operative Pain pain Morphine (NPC232533) NP level
NCT02935933 Paravertebral Morphine Versus Dexmedetomidine on Acute and Chronic Postmastectomy Pain Chronic pain Morphine (NPC232533) NP level
NCT03263689 Transversus Abdominis Plane Block Versus Spinal Morphine After Caesarean Section : A Comparison Study pregnancy Morphine (NPC232533) NP level
NCT04160520 Pramipexole and Morphine for Renal Colic Renal Colic Morphine (NPC232533) NP level
NCT02428062 Target Hemodynamics and Brain Injury During General Anesthesia in the Elderly Cognitive impairment Epinephrine (NPC236347) NP level
NCT02009722 Intrathecal Opioids for Pain Control After Cesarean Delivery: Determining the Optimal Dose pain Morphine (NPC232533) NP level
NCT03238430 Management of Pain Post Hepatectomy : Infiltration of Local Anesthetics Versus Continuous Spinal Analgesia . pain Morphine (NPC232533) NP level
NCT03970655 Functional Endoscopic Sinus Surgery Study sinusitis Epinephrine (NPC236347) NP level
NCT00272844 Treatment of the Cholesterol Defect in Smith-Lemli-Opitz Syndrome Smith-Lemli-Opitz syndrome Cholesterol (NPC28657) NP level
NCT03730714 Surgicel and Analgesic Reservoir pain Epinephrine (NPC236347) NP level
NCT02226913 Effect of Sodium Bicarbonate Buffered Lidocaine on the Success of IAN Block of Teeth With Irreversible Pulpitis pulpitis Epinephrine (NPC236347) NP level
NCT00195910 Safety and Efficacy Study of Hydromorphone and Morphine pain Morphine (NPC232533) NP level
NCT00305058 Trial Comparing Morphine to Hydromorphone in Elderly Patients With Severe Pain pain Morphine (NPC232533) NP level
NCT00346268 Morphine-Sparing Efficacy Of Parecoxib In Pain Treatment After Radical Prostatectomy pain Morphine (NPC232533) NP level
NCT01053039 The Use of Intrathecal Morphine in the Management of Acute Pain Following Decompressive Lumbar Spinal Surgery pain Morphine (NPC232533) NP level
NCT02946294 Modified Pectoral Nerves Block Versus Serratus Plane Block in Major Breast Cancer Surgery pain Epinephrine (NPC236347) NP level
NCT01136356 A Within Subject Comparison of Opioid Withdrawal in Opioid Dependent Individuals opioid dependence Morphine (NPC232533) NP level
NCT03875274 Morphine Added to Ropivacaine for FICB for Postoperative Analgesia pain Morphine (NPC232533) NP level
NCT02677532 Epidural Versus Wound Infusion Plus Morphine Bolus in Open Abdominal Aortic Aneurysm Repair pain Morphine (NPC232533) NP level
NCT02880540 Dexmedetomidine to Treat Bariatric Surgery-associated Pain obesity Morphine (NPC232533) NP level
NCT00349401 Intrathecal Ketorolac in Patients With Intrathecal Morphine Dose Escalation pain Morphine (NPC232533) NP level
NCT01304212 Effectiveness of Analgesia in Total Knee Arthroplasty pain Morphine (NPC232533) NP level
NCT01953978 The Effect of Dexamethasone in Combination With Paracetamol and Ibuprofen on Postoperative Pain After Spine Surgery pain Morphine (NPC232533) NP level
NCT02173756 Evaluation of Oral Morphine Gel in Oral Mucositis Induced by Chemotherapy in Children and Young Adults cancer Morphine (NPC232533) NP level
NCT04085913 Exparel Injection Effect on Postoperative Opioid Usage parathyroid adenoma Epinephrine (NPC236347) NP level
NCT02137525 Study to Explore Effectiveness of Sublingual Fentanyl Spray in Emergency Department Patients With Acute Pain pain Morphine (NPC232533) NP level
NCT02807298 4% Articaine and 2% Lidocaine by Intraligamentary Technique in Irreversible Pulpitis pulpitis Epinephrine (NPC236347) NP level
NCT05308420 PENG Block vs Intrathecal Morphine in Total Hip Arthroplasty pain Morphine (NPC232533) NP level
NCT03682224 Exparel and Marcaine for Pain Management in Thoracoscopic Lobectomy Patients non-small cell lung carcinoma Epinephrine (NPC236347) NP level
NCT00390039 Efficacy and Safety of Intranasal Morphine for Pain After Elective Orthopedic Surgery pain Morphine (NPC232533) NP level
NCT01526525 Perioperative Electroacupuncture on Postoperative Analgesia in Prostatectomy pain Morphine (NPC232533) NP level
NCT03570541 TQL-block for Laparoscopic Hemicolectomy pain Morphine (NPC232533) NP level
NCT00728832 A Pharmacokinetic (PK) Study of Extended-Release Epidural Morphine in Upper Abdominal Surgery pain Morphine (NPC232533) NP level
NCT04243954 Intravenous vs Oral Analgesia in Cancer Patients With Severe Pain After Successful Titration cancer Morphine (NPC232533) NP level
NCT03126968 Prophylactic Topical Epinephrine to Reduce Bleeding in Transbronchial Lung Biopsies Hemoptysis;hemorrhage Epinephrine (NPC236347) NP level
NCT05062356 Pain Control Following Total Hip Arthroplasty Chronic pain Epinephrine (NPC236347) NP level
NCT01873144 High Flow Therapy vs Hypertonic Saline in Bronchiolitis Bronchiolitis Epinephrine (NPC236347) NP level
NCT01686802 Post-operative Oral Morphine Versus Ibuprofen pain Morphine (NPC232533) NP level
NCT01671410 Buprenorphine for Treatment of Neonatal Abstinence Syndrome in Infants With In Utero Exposure to Benzodiazepines neonatal abstinence syndrome Morphine (NPC232533) NP level
NCT01071499 Pharmacokinetics of Oral Morphine and Pharmacogenomics of CYP2D6 and UGT2B7, in an Urban Pediatric Population Presenting for Elective Surgery pain Morphine (NPC232533) NP level
NCT02585531 Epinephrine, Dexamethasone and Hypertonic Saline in Bronchiolitis Bronchiolitis Epinephrine (NPC236347) NP level
NCT00634010 Morphine Versus Methadone As First Line Strong Opioid for Cancer Pain cancer Morphine (NPC232533) NP level
NCT00390312 Efficacy and Safety of Intranasal Morphine for Pain After Third Molar Extraction pain Morphine (NPC232533) NP level
NCT05413902 Multi-Modal Anesthesia Protocol in Pain Management of Patients Undergoing Posterior Lumbar Spinal Fusion Surgery pain Morphine (NPC232533) NP level
NCT03134703 Methadone Demonstration Project With Neonatal Intensive Care Unit Infants Diagnosed With Neonatal Abstinence Syndrome neonatal abstinence syndrome Morphine (NPC232533) NP level
NCT04188418 Fentanyl Buccal Tablet or Morphine for Exertional Dyspnea in Cancer Patients shortness of breath Morphine (NPC232533) NP level
NCT01835262 Low Dose Ketamine Versus Morphine for Moderate to Severe Pain in the Emergency Department pain Morphine (NPC232533) NP level
NCT02335294 A Study of TRV130 for the Treatment of Pain After Abdominoplasty pain Morphine (NPC232533) NP level
NCT03404908 TAP vs QLB in Patients After Cesarean Delivery pain Morphine (NPC232533) NP level
NCT03383588 Subcutaneous Bupivacaine Decrease Post-op Pain in Patients Undergoing C-Section pain Epinephrine (NPC236347) NP level
NCT01057381 Dexmedetomidine in Pediatric Tonsillectomy pain Morphine (NPC232533) NP level
NCT04533243 Opioid Titration With 12.5 ug/h Fentanyl Transdermal Patch vs Orally Morphine for Opioid-naïve Patients With Moderate Cancer Pain cancer Morphine (NPC232533) NP level
NCT02716129 The Effect of Adding Nalbuphine to Intrathecal Morphine on Analgesic Efficacy and Side Effects After Cesarean Section pain Morphine (NPC232533) NP level
NCT01064986 The Effects of Hydrocortisone in Endotoxemia in Normal Volunteers infection Epinephrine (NPC236347) NP level
NCT00000335 Activity Monitoring Assessment of Opiate Withdrawal - 4 opioid dependence Morphine (NPC232533) NP level
NCT02817477 Intranasal Ketamine for Acute Traumatic Pain pain Morphine (NPC232533) NP level
NCT00213200 Intravenous and Topical Analgesics for Procedural Pain in Neonates pain Morphine (NPC232533) NP level
NCT00142896 Tramadol to Reduce Opioid Withdrawal Symptoms opioid dependence Morphine (NPC232533) NP level
NCT04032119 RCT of Gastric ESD With or Without Epineprhine Added Solution gastric cancer Epinephrine (NPC236347) NP level
NCT02746263 Multicenter Study to Compare Intravenous and Oral Acetaminophen for the Treatment of Acute Moderate to Severe Pain pain Morphine (NPC232533) NP level
NCT00624650 Hemodynamics and Extravascular Lung Water in Acute Lung Injury acute lung injury Epinephrine (NPC236347) NP level
NCT01476124 Drug Drug Interaction Study With Gabapentin Enacarbil and Morphine restless legs syndrome Morphine (NPC232533) NP level
NCT04448561 A Study to Assess the Safety, Tolerability and Pharmacokinetics of Multiple Doses of ASP8062 With a Single Dose of Morphine in Recreational Opioid Using Participants opioid use disorder Morphine (NPC232533) NP level
NCT01706952 Comparison of Topical Vasoconstriction in Endoscopic Sinus Surgery sinusitis Epinephrine (NPC236347) NP level
NCT01861015 Vasopressin Versus Epinephrine in Myomectomy benign muscle neoplasm Epinephrine (NPC236347) NP level
NCT03241485 Trial Comparing Intrathecal Morphine With Placebo In Patients Undergoing Robotic Cardiac Surgery pain Morphine (NPC232533) NP level
NCT01680939 Investigating the Safety of Post-surgical Analgesics in Children With Obstructive Sleep Apnea obstructive sleep apnea Morphine (NPC232533) NP level
NCT05006235 Inhaled Beta-2 Agonist Versus Epinephrine For Treatment of Transient Tachypnea of Newborn (TTN) tachypnea Epinephrine (NPC236347) NP level
NCT03017248 Low-dose Ketamine for Acute Pain in the Emergency Department pain Morphine (NPC232533) NP level
NCT02152410 Acupuncture Versus IV Morphine in the Treatment of Acute Pain in ED Renal Colic Morphine (NPC232533) NP level
NCT04755712 Comparison of Two Analgesic Strategies After Scheduled Caesarean pain Morphine (NPC232533) NP level
NCT02749162 Perineural Dexamethasone in Femural Nerve Block After Ligament Reconstruction pain Morphine (NPC232533) NP level
NCT00494429 Optimizing the Use of Morphine in Pre-Term Neonates premature birth Morphine (NPC232533) NP level
NCT02264821 Wound Infusion vs Spinal Morphine for Post-caesarean Analgesia pain Morphine (NPC232533) NP level
NCT02435537 Combined Intrathecal Morphine and Dexmedetomidine Analgesia pain Morphine (NPC232533) NP level
NCT03428633 Thoracic Paravertebral Blocks in Open Nephrectomy pain Morphine (NPC232533) NP level
NCT00136682 Patient-Controlled Epidural Analgesia (PCEA) for Patients Who Have Had Major Open Gynecologic Surgery pain Morphine (NPC232533) NP level
NCT01255709 Epinephrine Inhalation Aerosol USP, CLINICAL STUDY-B3 FOR ASSESSMENT OF PHARMACOKINETICS asthma Epinephrine (NPC236347) NP level
NCT02749409 Early Parecoxib Usage to Decreases Narcotic Requirement and Length of Stay After Traumatic Rib Fracture rib fracture Morphine (NPC232533) NP level
NCT02530151 Intra-articular Morphine and Clonidine Injections for Pain Management in Hip Arthroscopy pain Morphine (NPC232533) NP level
NCT04009759 Influence of Morphine or Ketamine or Saline Applied During In-hospital Cardiopulmonary Resuscitation on Early Survival cardiac arrest Morphine (NPC232533) NP level
NCT02790099 Comparison of Surgical Rectus Sheath Block and Intrathecal Morphine pain Morphine (NPC232533) NP level
NCT01202487 Gluing Lacerations Utilizing Epinephrine injury Epinephrine (NPC236347) NP level
NCT04794738 A Clinical Study of SHR8554 Injection for the Treatment of Pain After Orthopedic Surgery pain Morphine (NPC232533) NP level
NCT03257319 Inhaled vs IV Opioid Dosing for the Initial Treatment of Severe Acute Pain in the Emergency Department pain Morphine (NPC232533) NP level
NCT04849455 Erector Spinae Plane Block Catheters and Intrathecal Morphine for Hepatic Resection pain Morphine (NPC232533) NP level
NCT03472469 MAST Trial: Multi-modal Analgesic Strategies in Trauma pain Morphine (NPC232533) NP level
NCT01697579 Study of the Pharmacokinetics, Pharmacodynamics, Safety and Tolerability of Fosaprepitant for the Prevention of Chemotherapy-Induced Nausea and Vomiting (CINV) in Children (MK-0517-029) Chemotherapy-induced nausea and vomiting Serotonin (NPC220765) NP level
NCT01966172 Multimodal Analgesic Treatment Versus Traditional Morphine Analgesia After Cardiac Surgery pain Morphine (NPC232533) NP level
NCT01933542 The Effect of Chlorzoxazone on Moderate to Severe Postoperative Pain After Spine Surgery pain Morphine (NPC232533) NP level
NCT02100748 A Study of TRV130 for the Treatment of Pain After Bunionectomy pain Morphine (NPC232533) NP level
NCT03005548 Cortical Modulation of Acute Post-thoracotomy Pain With Transcranial Direct Current Stimulation pain Morphine (NPC232533) NP level
NCT02248493 Intravenous Paracetamol for Postoperative Pain pain Morphine (NPC232533) NP level
NCT01304134 Oxycodone Hydrochloride Injection in the Postoperative Pain Relieving Treatment pain Morphine (NPC232533) NP level
NCT03224039 Intranasal Sufentanil Versus Intravenous Morphine for the Management of Acute Pain pain Morphine (NPC232533) NP level
NCT00385541 Comparison of Side Effects of Morphine and Hydromorphone Patient-Controlled Analgesia (PCA) pain Morphine (NPC232533) NP level
NCT01522534 Randomized Double Blind Controlled Trial Comparing a Blind Sciatic Nerve Block in the Popliteal Fossa to Intravenous Morphine for Traumatic Severe Acute Pain in the Prehospital Setting pain Morphine (NPC232533) NP level
NCT02936934 Comparison of Adverse Drug Reactions Associated for Oxycodone and Morphine in Postoperative Pain After Abdominal Hysterectomy pain Morphine (NPC232533) NP level
NCT03070054 LIA in Hip Arthroscopy Patients pain Epinephrine (NPC236347) NP level
NCT00681174 Controlled-Release Oxycodone For Postoperative Analgesia After Video-Assisted Thoracic Surgery pain Morphine (NPC232533) NP level
NCT00965068 Cholesterol in ASD: Characterization and Treatment Asperger syndrome;autism Cholesterol (NPC28657) NP level
NCT01357642 Epinephrine Inhalation Aerosol USP: For Evaluation Of Efficacy And Safety In Asthma Patients asthma Epinephrine (NPC236347) NP level
NCT02731430 Intrathecal Morphine for Postoperative Analgesia Following Laparoscopic Bariatric Surgery pain Morphine (NPC232533) NP level
NCT02096003 Intrathecal Hydromorphone for Pain Control After Cesarean Section pain Morphine (NPC232533) NP level
NCT02868944 Interest of the Injection of Morphine, in Addition to a Local Anesthetic When Performing a Combined Spinal-epidural for Labor Analgesia pregnancy Morphine (NPC232533) NP level
NCT00009841 Gene Therapy in Treating Patients With Advanced Head and Neck Cancer head and neck malignant neoplasia Cholesterol (NPC28657) NP level
NCT03580187 Nebulized Morphine in Chest Trauma Patients: A Prospective Study injury Morphine (NPC232533) NP level
NCT01080911 0.05 mg Versus 0.1 mg Spinal Morphine for Reducing Morphine Requirement After Vaginal Hysterectomy pain Morphine (NPC232533) NP level
NCT00155233 Interaction Between Nalbuphine and Morphine in PCA pain Morphine (NPC232533) NP level
NCT02277678 Comparison of Epidural Oxycodone and Epidural Morphine Pruritus Morphine (NPC232533) NP level
NCT00142519 Comparison of A Single Dose Combination of Methadone and Morphine With Morphine Alone for Treating Post-operative Pain pain Morphine (NPC232533) NP level
NCT01025648 Randomized, Placebo/Active Crossover Dose-ranging Study for Safety and Efficacy in Asthma Patients. asthma Epinephrine (NPC236347) NP level
NCT04766463 A Clinical Study of SHR8554 Injection for the Treatment of Pain After Abdominal Surgery. pain Morphine (NPC232533) NP level
NCT02302586 Thoracic Paravertebral Blockade in Video Assisted Thoracoscopic Surgery (VATS) pain Morphine (NPC232533) NP level
NCT02078089 Oxcarbazepine Plus Morphine in Patients With Refractory Cancer Pain cancer Morphine (NPC232533) NP level
NCT02456142 CAUDAL BUPIVACAINE VERSUS INTRAVENOUS MORPHINE ON TIME TO FIRST ANALGESIC REQUIREMENT pain Morphine (NPC232533) NP level
NCT02591771 Study of Multistep Pharmacological and Invasive Management for Cardiogenic Shock Shock Epinephrine (NPC236347) NP level
NCT01298297 Efficacy of Buprenorphine for Treatment of Acute Pain pain Morphine (NPC232533) NP level
NCT01708642 The Effect of Administration of Low Dose Adrenaline During Surgery on Bleeding During Hip Surgery hemorrhage Epinephrine (NPC236347) NP level
NCT02460913 Acupuncture Versus Intravenous Morphine in the Management of Acute Pain in the Emergency Department pain Morphine (NPC232533) NP level
NCT03001453 Intraoperative Liposomal Bupivacaine vs. Bupivacaine for Total Hip Replacement Pain Management pain Epinephrine (NPC236347) NP level
NCT03537612 Sensorial and Physiological Mechanism-based Assessments of Perioperative Pain scoliosis Morphine (NPC232533) NP level
NCT04630886 Use of Tranexamic Acid in Reduction of Post-Op Complications in Mohs Micrographic Surgery skin neoplasm Epinephrine (NPC236347) NP level
NCT01918917 Adding Intra-articular Dexmedetomidine to Levobupivacaine for Postoperative Analgesia in Arthroscopic Knee Surgery pain Morphine (NPC232533) NP level
NCT05260008 Study Assessing Pain Relief After Replacement of the Knee pain Epinephrine (NPC236347) NP level
NCT01882530 Non-opioid Analgesic Combination With Morphine for Postoperative Analgesia. pain Morphine (NPC232533) NP level
NCT01476904 Safety Study in Adolescent and Adult Patients With Asthma asthma Epinephrine (NPC236347) NP level
NCT02095366 Intra Nasal Sufentanil Versus Intravenous Morphine for Acute Severe Traumatic Pain Analgesia in Emergency Setting pain Morphine (NPC232533) NP level
NCT02820324 Study of Oliceridine (TRV130) for the Treatment of Moderate to Severe Acute Pain After Abdominoplasty pain Morphine (NPC232533) NP level
NCT03713216 Comparison of the Efficacy and Safety of NALDEBAIN With Conventional Treatment After Laparoscopic Cholecystectomy pain Morphine (NPC232533) NP level
NCT03592992 Spinal Hydromorphone Versus Morphine for Post-Cesarean Delivery Analgesia pain Morphine (NPC232533) NP level
NCT05218733 Ultrasound Guided Erector Spinae Plane Block vs Intrathecal Morphine pain Morphine (NPC232533) NP level
NCT01309386 A Safety and Efficacy Study of Oral Tapentadol Extended-Release in Japanese Participants neoplasm Morphine (NPC232533) NP level
NCT01038609 Hydrocodone/Acetaminophen for Acute Pain Following Bunionectomy pain Morphine (NPC232533) NP level
NCT02534571 To Compare a Hemostatic Powder TC-325 and Standard Treatment in the Control of Acute Upper Gastrointestinal Bleeding From Nonvariceal Causes Gastrointestinal hemorrhage Epinephrine (NPC236347) NP level
NCT02804022 Vital-signs-integrated Patient-assisted Intravenous Opioid Analgesia respiratory depression Morphine (NPC232533) NP level
NCT02620631 Study to Examine Pain Relief With Supplemental Intrathecal Morphine in TKA Patients pain Morphine (NPC232533) NP level
NCT01452789 Blinded Trial of Buprenorphine or Morphine in the Treatment of the Neonatal Abstinence Syndrome neonatal abstinence syndrome Morphine (NPC232533) NP level
NCT00358579 Comparing Vasopressin and Adrenaline in Patients With Cardiac Arrest cardiac arrest Epinephrine (NPC236347) NP level
NCT02478398 Efficacy and Safety Study of RAGWITEK™ (MK-3641) in Children With Ragweed-Induced Rhinoconjunctivitis With or Without Asthma (MK-3641-008) seasonal allergic rhinitis Epinephrine (NPC236347) NP level
NCT02815709 Study of Oliceridine (TRV130) for the Treatment of Moderate to Severe Acute Pain After Bunionectomy pain Morphine (NPC232533) NP level
NCT04359823 DSAP Treatment Comparison porokeratosis Cholesterol (NPC28657) NP level
NCT03236805 Intravenous Subdissociative-dose Ketamine Versus Morphine for Prehospital Analgesia pain Morphine (NPC232533) NP level
NCT00401882 Treatment of Ventricular Tachyarrhythmias Refractory To Shock With Beta Blockers: The SHOCK and BLOCK Trial sudden cardiac arrest;ventricular fibrillation;ventricular tachycardia Epinephrine (NPC236347) NP level
NCT03622489 Comparing Protocols for Analgesia Following Elective Cesarean Section pain Morphine (NPC232533) NP level
NCT01465191 Effect of Mu-opioid Receptor Genetics on 3 Doses of Spinal Morphine for Postoperative Analgesia After Cesarean Section pain Morphine (NPC232533) NP level
NCT05186454 Postoperative Pain Control by Use of Many Drugs in Small Doses Intrathecally pain Morphine (NPC232533) NP level
NCT02669004 Intermittent Epidural Bolus Versus Epidural Infusion for Posterior Spinal Fusion After Adolescent Idiopathic Scoliosis pain Morphine (NPC232533) NP level
NCT02586961 Nebulized Adrenalin and Oral Betamethasone in Children With Bronchiolitis Attending Pediatric Emergencies. Bronchiolitis Epinephrine (NPC236347) NP level
NCT00628550 Trial of Vasopressin and Epinephrine to Epinephrine Only for In-Hospital Pediatric Cardiopulmonary Resuscitation cardiac arrest Epinephrine (NPC236347) NP level
NCT01143051 Pharmacokinetics (PK) Study of Epinephrine Inhalation Aerosol in Healthy Volunteers asthma Epinephrine (NPC236347) NP level
NCT01975753 First Evaluation of Morphine Hydrochloride by Nebulisation in Healthy Volunteers pain Morphine (NPC232533) NP level
NCT03112135 Effect of Topical and Systemic Tranexemic Acid on Bleeding During Ear Exploration Surgery hemorrhage Epinephrine (NPC236347) NP level
NCT02698995 Perineural Low-dose Dexamethasone Added to Infraclavicular Block Anesthesia pain Morphine (NPC232533) NP level
NCT00820027 Study of MK-0663/Etoricoxib in Postorthopedic Knee Replacement Surgery Pain (MK-0663-098) pain Morphine (NPC232533) NP level
NCT03825198 Lumbar Erector Spinae Plane Block for Back Surgery Back pain Morphine (NPC232533) NP level
NCT04603911 RCT Comparing ESPB Solutions in Breast Surgery breast cancer Epinephrine (NPC236347) NP level
NCT02810782 How to Treat Opiate Withdrawal in Neonates neonatal abstinence syndrome Morphine (NPC232533) NP level
NCT00784472 Visceral Pain From the Upper Urinary Tract - a Trial on the Effect of Morphine and Oxycodone in Patients Undergoing PCNL nephrolithiasis Morphine (NPC232533) NP level
NCT02692313 Dose Response of Epinephrine diabetes mellitus Epinephrine (NPC236347) NP level
NCT03117595 CSE for Labour Analgesia: A Comparison of Two Intrathecal Regimens pain Morphine (NPC232533) NP level
NCT00244153 Intraarticular Opioids Vs Glucocorticosteroids in Gonarthritis rheumatic disease Morphine (NPC232533) NP level
NCT02145975 Efficacy of Fentanyl to Reduce the Time of Severe Postoperative Pain Relief Compared to Morphine pain Morphine (NPC232533) NP level
NCT00772187 Intraoperative and Postoperative Analgesia for Laparoscopic Surgery. pain Morphine (NPC232533) NP level
NCT05099055 Dexmedetomine as Adjuvant for Spinal Anesthesia in Elective Cesarian Sections : a Pilot Study pain Morphine (NPC232533) NP level
NCT03661996 An Open-label, 8-week Safety, Efficacy, and Assessment of Cooling Methods for Administration of CNTX-4975-05 for Knee OA osteoarthritis Epinephrine (NPC236347) NP level
NCT01079754 0.05 Versus 0.1 mg Spinal Morphine for Reducing Morphine Requirement After Vaginal Hysterectomy pain Morphine (NPC232533) NP level
NCT00996177 A Study to Compare Patient-controlled Pain Medications Delivered Either Through the Skin or Intravenously pain Morphine (NPC232533) NP level
NCT04582786 Dose Finding Study of STR-324 pain Morphine (NPC232533) NP level
NCT01675622 Immediate-Release Oxycodone Capsules Study in Cancer Pain cancer Morphine (NPC232533) NP level
NCT03675646 Spinal Morphine for Postoperative Analgesia in Urology pain Morphine (NPC232533) NP level
NCT04752033 Intrathecal Opioids for Colorectal Resection pain Morphine (NPC232533) NP level
NCT02622126 Colloid Pre-Loading on D-Dimer During Cesarean Section Under Spinal Anesthesia blood coagulation disease;hemorrhage Morphine (NPC232533) NP level
NCT02687347 Efficacy and Safety of Ultra-low Dose Methadone as Adjuvant Analgesic in Cancer Patients With Pain pain Morphine (NPC232533) NP level
NCT00803114 Epidural Morphine Following Vaginal Delivery pain Morphine (NPC232533) NP level
NCT02483221 Postoperative Pain Therapy With Hydromorphone TCI-PCA vs. Morphine PCA pain Morphine (NPC232533) NP level
NCT03063359 Intranasal Fentanyl Versus Oral Morphine Sulfate in the Treatment of Pain in Pediatric Trauma pain Morphine (NPC232533) NP level
NCT01844206 Two Dose Epidural Morphine for Post-cesarean Analgesia pain Morphine (NPC232533) NP level
NCT00478023 A Study to Evaluate the Efficacy and Safety of Tapentadol (CG5503) in the Treatment of Acute Pain After Abdominal Hysterectomy pain Morphine (NPC232533) NP level
NCT02752308 Effectiveness of Caudal Epidural Block on Intraoperative Blood Loss During Hypospadias Repair hypospadias Epinephrine (NPC236347) NP level
NCT00852410 The Hemostatic and Hemodynamic Effects of Adrenaline During Endoscopic Sinus Surgery sinusitis Epinephrine (NPC236347) NP level
NCT00411879 Combined Vasopressin, Methylprednisolone, and Epinephrine for Inhospital Cardiac Arrest sudden cardiac arrest Epinephrine (NPC236347) NP level
NCT03968146 Erector Spinae Plane Block in Scoliotic Adolescents scoliosis Morphine (NPC232533) NP level
NCT01094522 Measuring the Amount of Methadone or Morphine in the Blood of Neonates, Infants & Children After Cardiac Surgery. pain Morphine (NPC232533) NP level
NCT03502642 Ropivacaine Continuous Wound Infusion Versus Intrathecal Morphine for Postoperative Analgesia After Cesarean Delivery pain Morphine (NPC232533) NP level
NCT03396588 Non-Opiate Treatment After Prenatal Opiate Exposure to Prevent Postnatal Injury to the Young Brain neonatal abstinence syndrome Morphine (NPC232533) NP level
NCT02282956 Ultrasound Guided Single Shot Block of Posterior Tibial Nerve for Postoperative Pain Relief After Hallux Valgus Surgery pain Morphine (NPC232533) NP level
NCT00795223 Comparative Pain Control Between 0.2 or 0.3 Spinal Morphine and 0.25 or 0.5 % Bupivacaine for FNB After TKA pain Morphine (NPC232533) NP level
NCT02279628 Continuous Pre-uterine Wound Infiltration Versus Intrathecal Morphine for Postoperative Analgesia After Cesarean Section pain Morphine (NPC232533) NP level
NCT03151863 Intranasal Dexmedetomidine for Procedural Pain Management in Elderly Adults in Palliative Care pain Morphine (NPC232533) NP level
NCT02434939 Low-dose Ketamine vs Morphine for Vaso-occlusive Crisis in Sicklers pain Morphine (NPC232533) NP level
NCT01082471 An Efficacy and Safety Study to Compare Morphine 6-glucuronide (M6G) and Morphine in Patients Suffering With Post-Operative Pain for at Least 24 Hours pain Morphine (NPC232533) NP level
NCT02151682 A Study to Look at Tapentadol Tablets in Children and Adolescents in Pain pain Morphine (NPC232533) NP level
NCT03648008 Postoperative Analgesic Effect of Hydromorphone on Partial Pulmonary Resection Under Video-assisted Thoracoscopy pain Morphine (NPC232533) NP level
NCT02525718 Selective Intraoperative Administration of Local Anesthesia in Breast Reconstruction breast cancer Epinephrine (NPC236347) NP level
NCT00755989 Use of Morphine Gel Topically in Patients With Stage 2-3 Wounds injury Morphine (NPC232533) NP level
NCT02252926 Local Anesthetic Treatment of Oral Pain in Patients With Mucositis mucositis Morphine (NPC232533) NP level
NCT03275012 Efficacy and Safety Study of Gabapentin as add-on to Morphine in Paediatric Patients Affected by Chronic Pain Chronic pain Morphine (NPC232533) NP level
NCT02002130 The Use of Glutamic Acid Decarboxylase (GAD) and Gamma-Amino Butyric Acid (GABA) in the Treatment of Type I Diabetes type 1 diabetes mellitus Gamma-Aminobutyric Acid (NPC18188) NP level
NCT03383588 Subcutaneous Bupivacaine Decrease Post-op Pain in Patients Undergoing C-Section pain Morphine (NPC232533) NP level
NCT03534869 Auricular Acupuncture as Effective Pain Relief After Episiotomy pain Morphine (NPC232533) NP level
NCT04369950 Post-cesarean Analgesia With Epidural Morphine Following Epidural 2-chloroprocaine pain Morphine (NPC232533) NP level
NCT00803283 A Study to Compare Safety and Efficacy of Osmotic Release Oral Syytem (OROS) Hydromorphone Hydrochloride (HCl) With Morphine Sustain Release (SR) in Participants With Cancer Pain cancer Morphine (NPC232533) NP level
NCT02848729 Drug Interactions Between Morphine and Orally or IV Administered Acetaminophen pain Morphine (NPC232533) NP level
NCT03585374 Trauma Acute Pain Treatment With Methoxyflurane Vaporized (PENTHROX®): Efficacy and Safety Study (MEDITA) injury Morphine (NPC232533) NP level
NCT01572116 Effect of Sufentanil on the Rate of Anesthesia pulpitis Epinephrine (NPC236347) NP level
NCT04733781 Subcutaneous Injection of Large Volumes of Tumescent Lidocaine and Epinephrine by Laypersons pain Epinephrine (NPC236347) NP level
NCT04696822 Bioavailability of Nasal Epinephrine anaphylaxis Epinephrine (NPC236347) NP level
NCT00121524 Effects of Epinephrine and Intravenous (I.V.) Needle on Cardiopulmonary Resuscitation (CPR) Outcome cardiac arrest Epinephrine (NPC236347) NP level
NCT04061265 Articaine Efficacy and Safety for Children Below Age of 4-years pain Epinephrine (NPC236347) NP level
NCT03034382 Morphine and/or Nalbuphine as Adjuvants in Ultrasound Guided Interscalene Block: for Shoulder Surgeries rotator cuff tear Epinephrine (NPC236347);Morphine (NPC232533) NP level
NCT02462577 Effect of Locally Administered Morphine and Bupivicaine on Acute and Chronic Postmastectomy Pain Chronic pain Morphine (NPC232533) NP level
NCT03639389 Postoperative Pain, Recovery and Discharge Following Robot-assisted Laparoscopic Prostatectomy pain Morphine (NPC232533) NP level
NCT03023982 Pectoralis and Serratus Nerves Block in Thoracic Surgery injury Morphine (NPC232533) NP level
NCT04717193 Laparoscopically Guided Rectus Sheath Block in Pediatric Appendicitis appendicitis Epinephrine (NPC236347) NP level
NCT01322191 Morphine PK Subgroup Analysis pain Morphine (NPC232533) NP level
NCT00287326 Comparison of Low-dose Epidural With Intravenous Narcotic Versus Intravenous Narcotic Alone pain Morphine (NPC232533) NP level
NCT00672347 Clonidine and Morphine in Caudal Anesthesia pain Morphine (NPC232533) NP level
NCT01367418 Effects of Anesthetic Technique on Immune and Inflammatory Systems Following Radical Prostatectomy prostate cancer Morphine (NPC232533) NP level
NCT00656773 A Randomized, Double-blind Comparison of Morphine and Sufentanil for Prehospital Traumatic Severe Acute Pain pain Morphine (NPC232533) NP level
NCT00264485 A Comparison of the Safety and Effectiveness of Two Forms of Patient-controlled Pain Medication Used After Total Hip Replacement: The E-TRANS Fentanyl Transdermal System Versus the Morphine Intravenous Pump pain Morphine (NPC232533) NP level
NCT05375305 A Study of SHR8554 Injection for the Treatment of Pain After Orthopedic Surgery pain Morphine (NPC232533) NP level
NCT00374881 A Study of the Safety and Efficacy of Combination Therapy With Morphine, Phenylephrine and Sorbitol in Human Subjects pain Morphine (NPC232533) NP level
NCT01533155 Study in Healthy Volunteers to Investigate the Effects of Quinidine on the Pharmacokinetics of NKTR-118 Constipation Morphine (NPC232533) NP level
NCT03948464 Slow-Release Oral Morphine for the Treatment of Opioid Use Disorder opioid dependence Morphine (NPC232533) NP level
NCT01071057 Naloxone for the Treatment of Opioid-Induced Pruritus Pruritus Morphine (NPC232533) NP level
NCT04148261 Epinephrine and Cortisol in Depression depressive disorder Epinephrine (NPC236347) NP level
NCT02860949 Multimodal Drug Infiltration in Total Knee Arthroplasty: Is Posterior Capsular Infiltration Worth the Risk? osteoarthritis, knee Epinephrine (NPC236347) NP level
NCT00737997 Effect of Early Morphine Administration on the Development of Acute Opioid Tolerance During Pediatric Scoliosis Surgery scoliosis Morphine (NPC232533) NP level
NCT02954484 Outcomes Of Perioperative Pregabalin On Total Knee Arthroplasty pain Morphine (NPC232533) NP level
NCT02238288 Randomized Clinical Trial With Aminocaproic Acid in the Prevention of Exodontic Bleeding in Anticoagulants Patients hemorrhage Epinephrine (NPC236347) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Obesity
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B80-5B81
 ADRB2,ADRB3,OPRM1,ADRA2C,ADRB1,HTR2C,HTR6,ADRA1B
 NCT02880540
Substance abuse
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C40
 HTR2C,ADRA2C,OPRK1,OPRM1,ADRA2A,ACHE,GABBR2,DRD2,ADRA2B
Migraine
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A80
 DRD2,HTR1D,HTR2C,OPRM1,HTR1F,OPRD1,ADRB1,HTR1A,HTR1B
Schizophrenia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20
 DRD2,DRD3,HTR7,HTR1B,HTR2A,HTR6,HTR2C,GABBR2,HTR1A
Pituitary gland disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A60-5A61
 DRD2,HTR1F,HTR1E,HTR5A,HTR2A,HTR1D,HTR1B,HTR2C,HTR2B
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 XDH,MKNK2,DRD3,DRD2,RORC,CSNK2A1,GABBR2,ADRA1D,F3
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 HTR1D,ADRB3,CYP1B1,GABBR2,ADRA2C,GABRA6,DPP4,XDH,ADRA1B
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CYP1A2,TTR,ADRB2,HTR3A,HTR4,OPRK1,CYP1A1,ADRB1,DRD2
Indeterminate colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD72
 ESR2,GABRA5,GABRB2,GABRA2,SLC6A11,GABBR2,GABRG2,GABRA3
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 ADRB1,DRD2,ACHE,ADRA2C,ADRB2,ADRA1D,ADRB3,HTR2A
Unspecific body region injury
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: ND56
 NCT03511833,NCT01123551,NCT00755989,NCT01202487,NCT03580187,NCT03865147,NCT03585374,NCT03023982
Cardiac arrest
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MC82
 NCT00358579,NCT00628550,NCT05166343,NCT00401882,NCT00121524,NCT00729794,NCT00411879,NCT04009759
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 HTR1D,GABRR1,GABRA2,HTR2C,GABRA5,ADRA1B,SLC6A12,TTR
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 ADRA2B,ADRA1A,SLC6A11,CYP19A1,HTR4,XDH,F3,LMNA
Anxiety
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MB24.3
 HTR6,OPRD1,HTR1A,GABRA3,HTR2A,DRD2,HTR2C
Mild neurocognitive disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D71
 ACHE,HTR6,HTR7,ADRA1A,GABRA5,HTR4,HTR1A
Heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10-BD1Z
 DRD2,MPO,ADRA1D,XDH,HTR4,ADRB1
 NCT00446017
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 GABRA3,GABRR1,SLCO1B3,CYP19A1,BLM,F2,HTR2C
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 HTR7,HTR1D,SLCO1B3,F2,HTR2C,GABRA5,ADRA1B
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 CYP1A1,HTR1D,OPRD1,SLCO1B3,F2,HTR2C,DRD2
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 GABRA3,HTR3A,SLC6A11,HSD17B1,SLCO1B3,HTR2C,XDH
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 HSD17B1,GABBR2,SLCO1B3,BLM,HTR2C,CYP1A2,TTR
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CSNK2A3,CYP1B1,GABRR1,BLM,DPP4,LMNA,CYP19A1
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 ADRB2,CYP19A1,ESR2,MKNK2
 NCT02525718,NCT04603911
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 HTR1A,DPP4,DRD2,RORC
 HTR7,HTR3A
Psychotic disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20-6A25
 HTR1B,HTR2C,HTR1A,HTR2B,DRD2,HTR2A
Bipolar disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A60
 DRD3,HTR2A,HTR7,OPRK1,HTR1A,DRD2
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 CYP1A1,GABBR2
 NCT04551703,NCT01706952,NCT00852410,NCT03970655
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 HSD17B1,DPP4,ACHE,GABRA5,ADRA2A,LMNA
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 DPP4,F2,ADRB3,HTR2A,DRD2
Tonus and reflex abnormality
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MB47
 HTR2C,HTR1A,GABRG2,GABRB2,HTR1B
Sexual dysfunction
Disease Category: 17.Conditions related to sexual health
Disease ICD-11 Code: HA00-HA01
 DRD3,HTR1A,ADRA1D,HTR2A,DRD2
Irritable bowel syndrome
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD91
 HTR4,OPRD1,HTR3A,OPRM1,OPRK1
Insomnia
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A00-7A0Z
 HTR1D,GABRB2,HTR2A,HTR1A,DRD2
Epilepsy/seizure
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A61-8A6Z
 HTR3A,GABRB2,GABBR2,GABRG2,HTR1D
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 ADRB3,HTR2A,DPP4,HTR2C,ADRB1
Haemorrhage, not elsewhere classified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG27
 NCT02238288,NCT03112135,NCT03126968,NCT02622126,NCT01708642
Neonatal withdrawal syndrome from maternal use of drugs of addiction
Disease Category: 19.Certain conditions originating in the perinatal period
Disease ICD-11 Code: KD35
 NCT03396588,NCT03134703,NCT01671410,NCT01452789,NCT02810782
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 MPO,HTR7,BLM,DPP4,SLC6A12
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 GABRA3,HTR1D,SLCO1B3,BLM,ACHE
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 CYP1A1,ADRA2B,ACHE,F3,DRD2
Pruritus
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EC90
 OPRK1,OPRM1
 NCT02277678,NCT01071057
Autism spectrum disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A02
 GABRA5,DPP4,GABBR2
 NCT00965068
Chronic kidney disease
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB61
 XDH,ADRA2C,HTR2A,DRD2
Functional bladder disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GC50
 ADRB3,ADRB3,ADRB2,OPRD1
Dementia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D80-6D8Z
 HTR2A,ACHE,HTR1D,HTR1A
Nausea/vomiting
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD90
 DRD2,HTR4,HTR3A
 NCT01697579
Chronic obstructive pulmonary disease
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA22
 ADRB2,ADRB3
 NCT01718496,NCT00982891
General pain disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E43
 ADRA2B,DRD2,OPRM1,ADRA2C
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 HTR1A,HTR1B,DPP4,HTR2C
Mood disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A60-6E23
 HTR1A,HTR2A,HTR1B,HTR1D
Renal colic
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MF56
 NCT04160520,NCT02781415,NCT01906762,NCT02152410
Bronchitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA20
 NCT01873144,NCT03567473,NCT02586961,NCT02585531
Pulpitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA09.0
 NCT02807298,NCT01794533,NCT01572116,NCT02226913
Pregnancy/childbirth/puerperium maternal infection
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JB63
 NCT03607916,NCT02868944,NCT03036384,NCT03263689
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 RORC,F2,SLC6A12,F3
Gastroduodenal motor/secretory disorder
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA41
 DRD3,HTR4,DRD2
Intentional self-harm
Disease Category: 23.External causes of morbidity or mortality
Disease ICD-11 Code: PC91
 GABRA5,GABRA2,GABRA3
Multiple sclerosis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A40
 F2,RORC,GABBR2
Post-traumatic stress disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6B40
 HTR2A,HTR4,ADRA2C
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 ADRA1A,ESR2
 NCT01367418
Prostate hyperplasia
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA90
 ADRA1A,ADRA1D,ESR2
Pancreatic cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 HTR2A,F3,DRD2
Vasomotor/allergic rhinitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA08
 ESR2,ADRA2C
 NCT02478398
Supraventricular tachyarrhythmia
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC81
 ADRB2,HTR4,ADRB1
Hypotension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA20-BA21
 DRD2,ADRA2C
 NCT05327556
Digestive system disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DE2Z
 OPRM1,DRD2,HTR4
Sleep-wake disorder
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A00-7B2Z
 HTR2A,HTR2C,GABRA3
Ischaemic/haemorrhagic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B20
 ADRB3,THPO,F2
Myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41-BA43
 DPP4,F2,THPO
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 DRD2,F2,HTR2A
Coronary vasospastic disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA85
 OPRK1,OPRD1,OPRM1
Mature T-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A90
 DRD2,MKNK2,DRD3
Stomach cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 ADRB2,DRD3,DRD2
Spinal pain
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: ME84
 OPRM1,OPRD1
 NCT03825198
Scoliosis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA70.1
 NCT03537612,NCT00737997,NCT03968146
Neoplasms
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 02
 NCT01825993,NCT02852382,NCT01309386
Malignant neoplasms of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 GABRA2,GABBR2
 NCT04032119
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 CYP19A1,DPP4,ACHE
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 GABRA3,OPRM1,HTR1B,SLC6A11,ADRA2A,HTR1F,TTR,HTR7,HTR1D,HTR5A,HTR3A,GABRR1,BLM,OPRK1,GABRA5,HTR6,HTR1E,OPRD1,RORC,GABRA2,HTR2A,HTR1A,ADRB1,ACHE,XDH,DRD2
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 GABRA3,HTR1B,CYP1B1,TTR,HTR7,HTR1D,ADRB3,HTR3C,GABRR1,GABBR2,BLM,DPP4,ADRA1B,SLCO1B3,GABRA2,HTR2A,LMNA,F2,HTR2B,ACHE,XDH,DRD2
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 GABRA3,CSNK2A3,SLC6A11,ADRA2C,HTR2C,CYP1A2,HTR1D,CSNK2A1,GABRR1,GABBR2,OPRK1,GABRA5,HTR6,OPRD1,RORC,SLCO1B3,ADRB1,PSMB5,SLC6A12,XDH,DRD2
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 GABRA3,HSD17B10,HTR2C,MPO,HTR7,HTR1D,HTR3A,GABRR1,GABBR2,OPRK1,DPP4,GABRA5,HTR6,OPRD1,RORC,GABRA2,ADRB1,CYP19A1,PSMB5,XDH
Essential hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00
 DRD2,ADRB1
Psychoactive substances use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C4G
 HTR2C,DRD3
Breathing abnormality
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD11
 OPRM1,DRD2
Sepsis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G40-1G41
 ESR2,ADRB1
Coronary atherosclerosis
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA80
 HTR1A,ADRB1
Postoperative inflammation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-CA43
 MPO,HTR1A
BCR-ABL1-negative chronic myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A41
 DRD3,DRD2
Acute upper respiratory infection
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA07
 DRD3,DRD2
Melanoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 ADRB1,ADRB2
Restless legs syndrome
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A80
 DRD2
 NCT01476124
Conduction disorder
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC63
 ADRB1,ADRB2
Cough
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD12
 OPRM1,OPRD1
Chronic arterial occlusive disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 DPP4,ADRA2C
Multiple myeloma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A83
 DRD3,DRD2
Chronic insomnia
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A00
 HTR2A,HTR2C
Cushing syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A70
 ESR2,CYP19A1
Schizoaffective disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A21
 HTR2A,DRD2
Bowel habit change
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: ME05
 OPRD1,OPRM1
Liver cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12
 MKNK2,CSNK2A1
Mental/behavioural/neurodevelopmental disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6E20-6E8Z
 OPRM1,ADRA1B
Neuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C0Z
 CYP19A1,OPRM1
Crohn disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD70
 RORC
 SLCO1B3
Corneal disease
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9A76-9A78
 HTR3A,OPRM1
Herpes simplex infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F00
 ADRA2C
 NCT01064986
Angina pectoris
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40
 ADRB3,F2
Allergic/hypersensitivity disorder
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A80-4A8Z
 DRD2,ADRB1
Lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 RORC,DRD2
Intellectual development disorder
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD90
 HTR1A,DRD2
Bleeding disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA20-GA21
 F2,F3
Endometrial cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76
 DRD3,DRD2
Dissociative neurological symptom disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6B60
 ADRA2C,HTR6
Cerebral ischaemia
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B1Z
 HTR2A,DRD2
Idiopathic interstitial pneumonitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB03
 HTR2A,DRD2
Diabetes mellitus, type unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A14
 DPP4
 NCT02692313
Social anxiety disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6B04
 HTR2A,HTR1A
Brain cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00
 DRD3,DRD2
Non-specific cutaneous vascular sympton
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: ME64
 ADRA2C,OPRK1
Obstructive sleep apnoea
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A41
 NCT01680939,NCT02014714
Head and neck cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D42
 NCT00009841,NCT04221165
Idiopathic pulmonary fibrosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB03.4
 HTR2A,SLCO1B3
Myotonic dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71.0
 CYP1A1,ADRA2A
Pneumonia due to Pseudomonasaeruginosa
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA40.05
 DPP4,ADRA1B
Adenocarcinoma of prostate
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82.0
 SLCO1B3,TTR
Heart failure, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD1Z
 CYP1B1,HTR2A
Gliomas of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.0
 BLM,ADRB2
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 ADRA1A,DRD2,OPRM1,ADRA1D,ADRA2C,ADRA2A,OPRK1,HTR2C,OPRD1,ADRA1B,ADRA2B,ACHE
 NCT03268278,NCT00803114,NCT00305058,NCT02353754,NCT02009722,NCT04582786,NCT01071499,NCT03117595,NCT04794738,NCT00766506,NCT03011333,NCT03648008,NCT03005548,NCT03241485,NCT03238430,NCT01053039,NCT03579446,NCT04061330,NCT01526525,NCT00558870,NCT01304212,NCT03098420,NCT00996177,NCT03843281,NCT00672347,NCT03774836,NCT01522534,NCT02749162,NCT05308420,NCT02115087,NCT03534869,NCT01322191,NCT00609466,NCT01866254,NCT03730714,NCT02100748,NCT04849455,NCT02096003,NCT00656773,NCT02716129,NCT02677532,NCT01882530,NCT01084161,NCT04755712,NCT00298571,NCT01933542,NCT01080911,NCT02673372,NCT01953978,NCT00155233,NCT03068260,NCT03236805,NCT01835262,NCT03257319,NCT00872885,NCT00346268,NCT02620631,NCT05413902,NCT00362219,NCT02954484,NCT02815709,NCT03570541,NCT01082471,NCT00795223,NCT02111746,NCT01079754,NCT03383588,NCT03063359,NCT05375305,NCT01686802,NCT03025594,NCT02435537,NCT03224039,NCT02848729,NCT03675646,NCT03017248,NCT02300194,NCT03472469,NCT03713216,NCT00142519,NCT00385541,NCT04766463,NCT03592992,NCT02279628,NCT03001453,NCT05186454,NCT01245244,NCT02460913,NCT04911062,NCT00136682,NCT02790099,NCT02410317,NCT01038609,NCT02912195,NCT00287326,NCT05338320,NCT02264821,NCT03288428,NCT03012971,NCT00528177,NCT03639389,NCT01975753,NCT02223533,NCT02669004,NCT00264485,NCT04752033,NCT02095366,NCT01782781,NCT04369950,NCT00681174,NCT01077752,NCT02511483,NCT01951963,NCT03095222,NCT04061265,NCT01298297,NCT01979354,NCT04733781,NCT04887649,NCT05260008,NCT03875274,NCT01094522,NCT03070054,NCT02282956,NCT03622489,NCT03254459,NCT00772187,NCT00478023,NCT03035578,NCT03549221,NCT00213200,NCT02530151,NCT02936934,NCT02523846,NCT05218733,NCT02302586,NCT03502642,NCT01966172,NCT01830296,NCT01539538,NCT03151863,NCT00374881,NCT02746263,NCT01057381,NCT03007121,NCT00820027,NCT02335294,NCT02151682,NCT00195910,NCT01844206,NCT00728832,NCT04527393,NCT02976597,NCT02456142,NCT02137525,NCT00237731,NCT00390312,NCT02946294,NCT05099055,NCT01304134,NCT05324995,NCT03428633,NCT02248493,NCT02083315,NCT02698995,NCT02568995,NCT00349401,NCT02820324,NCT00390039,NCT05281081,NCT01465191,NCT02152514,NCT02817477,NCT05037539,NCT02687347,NCT02726828,NCT02044302,NCT00266539,NCT03404908,NCT02483221,NCT02145975,NCT02731430,NCT04852003,NCT02434939,NCT01918917
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 GABRA3,HTR1D,HTR3A,SLC6A11,ADRA1D,GABBR2,ADRA2C,HTR4,BLM,GABRA2,CYP19A1,HTR2C,GABRA3,HTR1D,SLC6A11,GABBR2,HTR4,CYP19A1,GABRA2
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 GABRA3,SLC6A11,THPO,HTR2C,ADRA2A,TTR,HTR1D,HTR3A,GABRR1,GABBR2,BLM,OPRK1,GABRA5,OPRD1,SLCO1B3,F2,HTR2B,ACHE,XDH
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 SLC6A11,THPO,ADRA1D,ADRA2C,HTR7,HTR1D,HTR3A,OPRK1,ADRA1B,HTR6,OPRD1,CYP1A1,ADRA2B,ADRB1,ESR2,ACHE,SLC6A12,DRD2
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 GABRA3,HSD17B10,CYP1B1,ADRA2C,HTR2C,HTR1F,MPO,HTR7,HTR5A,GABRR1,OPRK1,DPP4,GABRA5,HTR2A,ACHE,PSMB5,DRD2
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 HSD17B10,THPO,CSNK2A2,ADRA2C,ADRA2A,ADRB3,HTR3A,CSNK2A1,BLM,ADRA1B,LMNA,ESR2,HTR2B,ACHE,PSMB5,F3
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 GABRA3,SLC6A11,HTR2C,HTR7,HTR3A,GABRR1,BLM,OPRK1,GABRA5,HTR1E,SLCO1B3,ADRA2B,HSD17B1,F2,XDH,DRD2
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 GABRA3,HTR1B,SLC6A11,CSNK2A2,ADRA2A,HTR1F,HTR7,HTR1D,DPP4,GABRA5,OPRD1,GABRA2,HTR2A,LMNA,XDH,DRD2
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 GABRA3,HTR1B,ADRA2C,HTR2C,TTR,HTR1D,ADRB3,HTR3A,BLM,DPP4,GABRA5,OPRD1,F2,ACHE,XDH
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 HTR2C,GABRA5,DRD3,HTR7,ACHE,ADRA2C,HTR6,HTR1A,HTR4,HTR2A,ESR2,HTR1D,DRD2,HTR1B
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 ADRB1,ADRB3,DRD2,F2,ADRB2
 NCT01737892,NCT01737905,NCT01025648,NCT01460511,NCT01705964,NCT01255709,NCT01476904,NCT01357642,NCT01143051
Chronic pain
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG30
 HTR2A,GABBR2,ADRA2C,OPRD1,OPRM1,HTR3A,OPRK1
 NCT03275012,NCT02935933,NCT05062356,NCT00383682,NCT05187520,NCT02462577
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 GABRA3,HTR1B,SLC6A11,ADRA1D,ADRA2C,HTR1F,MPO,HTR1D,GABRR1,HTR4,BLM,OPRD1,CYP19A1
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 GABRA3,HTR5A,SLC6A11,GABBR2,ADRA2C,ADRA2A,BLM,DPP4,CYP19A1,HTR2C,GABRA5,HTR1F,HTR1E
Opioid use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C43
 ADRA2A,OPRK1,OPRM1,OPRD1
 NCT00460239,NCT04448561,NCT00142896,NCT03948464,NCT00000335,NCT03678792,NCT03015246,NCT01136356
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 CSNK2A3,SLC6A11,ADRA2C,ADRA2A,HTR1D,HTR3A,CSNK2A1,GABBR2,BLM,LMNA,ESR2,F3
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 HTR1D,HTR3A,OPRD1,GABBR2,CYP19A1,ACHE,XDH,HTR7,OPRD1,GABBR2,F2,HTR6
Pulmonary hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BB01
 DRD2,ADRB3,HTR2B,HTR1A,DRD2,ADRB1,ADRA1A,ADRA2C,ADRB2,ADRA1D,ADRA1B
Depression
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A70-6A7Z
 HTR1A,HTR2A,GABBR2,DRD3,DRD2,ADRA2A,HTR2C,HTR2B,OPRM1,OPRK1,HTR7
Parkinsonism
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00
 ADRB3,DRD3,HTR1B,HTR7,HTR2A,HTR1A,DRD2,HTR6,HTR2C,ACHE,MPO
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 MPO,ADRA2B,ADRB1,THPO,CYP1B1,DPP4,HTR2B,SLC6A12,ADRA1B,HTR6,HTR2A
Attention deficit hyperactivity disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A05
 HTR2A,DRD3,DRD2,HTR2C,ADRA1B,HTR7,HTR2B,HTR1A,HTR1B,ADRA2A
Unspecified malignant neoplasms of unspecified sites
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D4Z
 NCT02740127,NCT00201539,NCT00634010,NCT02078089,NCT02173756,NCT04243954,NCT00803283,NCT04533243,NCT01675622,NCT03120403
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 HTR2C,HTR3A,GABRR1,BLM,OPRK1,HTR6,SLCO1B3,CYP1A1,F2,XDH
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 GABRA3,THPO,HTR2C,HTR1D,HTR3A,GABBR2,BLM,GABRA5,HTR1E,OPRD1
Prurigo
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EC91
 OPRK1
Coagulation defect
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B10
 F2
Hyper-lipoproteinaemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80
 ESR2
Thrombosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB61-GB90
 F2
Endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10
 CYP19A1
Thrombocytopenia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64
 F2
Inborn purine/pyrimidine/nucleotide metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C55
 XDH
Large intestine motility disorder
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB32
 OPRM1
Hepatitis virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E50-1E51
 ESR2
Adaptive immunity immunodeficiency
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A01
 GABRA5
Choreiform disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A01
 DRD2
Binge eating disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6B82
 OPRM1
Dermal/subcutaneous connective tissue atrophy/degeneration
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EE40
 ADRB2
Itching
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F28-1G07
 DRD2
Coronavirus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D92
 CSNK2A1
Coronary thrombosis
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA43
 F2
Sleep-related breathing disorder
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A4Z
 ADRB2
Hyperaemia
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9A61-9B7Y
 DRD2
Tension-type headache
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A81
 OPRM1
Diabetic foot ulcer
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD54
 ADRB1
Postpartum haemorrhage
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA43
 DRD2
Parasitic worm infestation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F90
 ACHE
Oesophageal/gastroduodenal disorder
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD90
 ACHE
Metabolic disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5D2Z
 DPP4
Cardiac arrhythmia
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC9Z
 ADRB1
Gastro-oesophageal reflux disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA22
 HTR4
Ventricular tachyarrhythmia
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC71
 ADRB1
Pediculosis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G00
 ACHE
Dyspepsia
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD92
 HTR4
Cachexia
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG20
 ADRB2
Sex development malformative disorder
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD2A
 GABRA5
Bulimia nervosa
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6B81
 HTR1A
Faecal incontinence
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: ME07
 DRD2
Gangrene
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MC85
 DRD2
Hypoactive sexual desire dysfunction
Disease Category: 17.Conditions related to sexual health
Disease ICD-11 Code: HA00
 HTR1A
Skin/mucosal anomaly
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD27
 HTR1A
NA
Disease Category: NA
Disease ICD-11 Code: NA
 DRD2
Cardiomyopathy
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC43
 TTR
Nasopharyngeal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6B
 DRD3
Juvenile idiopathic arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA24
 HTR1A
Autoimmune disease
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40-4A45
 RORC
Dystonic disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A02
 ADRB3
Inborn porphyrin/heme metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C58
 DRD2
Circulatory system disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BE2Z
 ADRB1
Narcolepsy
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A20
 GABBR2
Endocrine gland neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2F37
 DRD2
Abnormal micturition
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MF50
 ADRB3
Skin sensation disturbance
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: ME65
 OPRM1
Oesophagitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA24
 CYP19A1
Menopausal disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA30
 ESR2
Encephalopathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E47
 XDH
Myasthenia gravis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C6Y
 ACHE
Thyrotoxicosis
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A02
 DRD2
Acute pain
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG31
 OPRM1
Cerebral ischaemic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B11
 F2
Amyloidosis
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5D00
 TTR
Neurodegenerative disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20-8A23
 HTR6
Muscular atrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B61
 HTR1A
Mineral deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B5K
 XDH
Ejaculatory dysfunction
Disease Category: 17.Conditions related to sexual health
Disease ICD-11 Code: HA03
 HTR1A
Carcinoid syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B10
 DRD2
Central and peripheral nervous disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A04-8E7Z
 ADRB1
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 OPRD1
Fragile X chromosome
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD55
 GABBR2
Preterm labour/delivery
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JB00
 ADRB2
Colorectal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B91
 MKNK2
Acute respiratory distress syndrome
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB00
 F3
Unspecific substance harmful effect
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE6Z
 ACHE
Influenza
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E30-1E32
 XDH
Skin and skin-structure infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F28-1G0Z
 ADRB2
Nutritional deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B50-5B71
 F2
Gout
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA25
 XDH
Symptoms and signs involving cognition, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MB21.Z
 NCT02428062
Type1diabetesmellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A10
 NCT02002130
Hypospadias
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LB53
 NCT02752308
Fracture of unspecified body region
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: ND56.2
 NCT03473093
Sickle-cell disorder
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3A51
 NCT03933397
Septic shock
Disease Category: X.Extension Codes
Disease ICD-11 Code: XS26
 NCT00134212
Other specified disorders of the nervous system
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E4Y
 NCT02804022
Appendicitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB10
 NCT04717193
Acute myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41
 NCT01186445
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 NCT03825887
Neuropathic pain
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E43.0
 NCT01914042
Other specified benign neoplasm of endocrine glands
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2F37.Y
 NCT04085913
Constipation
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: ME05.0
 NCT01533155
Rotator cuff syndrome
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB53.1
 NCT03034382
Fracture of rib
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NA82.3
 NCT02749409
Preterm newborn, unspecified
Disease Category: 19.Certain conditions originating in the perinatal period
Disease ICD-11 Code: KA21.4Z
 NCT00494429
Benign smooth muscle or skeletal muscle tumour
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2E86
 NCT01861015
Other specified acute tonsillitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA03.Y
 NCT01691690
Diseases of the musculoskeletal system or connective tissue
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 15
 NCT00244153
Osteoarthritis of knee
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA01
 NCT02860949
Oral mucositis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA01
 NCT02252926
Opioid dependence, unspecified
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C43.2Z
 NCT03015246
Other allergic rhinitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA08.03
 NCT01700192
Fractures involving multiple body regions
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: ND32
 NCT01807429
Anaphylaxis
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A84
 NCT04696822
Osteoarthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA00-FA05
 NCT03661996
Ventricular tachycardia
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC71.0
 NCT00401882
Shock
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG40
 NCT02591771
Gastrointestinal bleeding, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: ME24.9Z
 NCT02534571
Porokeratoses
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED52
 NCT04359823
Musculoskeletal system/connective tissue disease
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FC0Z
 NCT05355597
Disorders of oral mucosa
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA01
 NCT01837446
Dyspnoea
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD11.5
 NCT04188418
Ventricular fibrillation
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC71.1
 NCT00401882
Blood-forming organ disease
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3C0Z
 NCT02622126
Cholelithiasis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DC11
 NCT00784472
Neoplasms of unknown behaviour of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2F92
 NCT04630886
Depressive disorders, unspecified
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A7Z
 NCT04148261
Non-small cell lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 NCT03682224
Adenocarcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D40
 NCT05325164
Haemoptysis
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD22
 NCT03126968
Injury of lung, unspecified
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NB32.3Z
 NCT00624650
Other specified abnormalities of breathing
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD11.Y
 NCT05006235
Autism spectrum disorder without disorder of intellectual development and with mild or no impairment of functional language
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A02.0
 NCT00965068
Disorders of cholesterol synthesis
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C52.10
 NCT00272844
Retention of urine
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MF50.3
 NCT02848599
Coeliac disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA95
 CYP1A1
Myelodysplastic syndromes, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A3Z
 ADRA2B
Inflammatory bowel diseases, unspecified
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD7Z
 SLCO1B3
Zika virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D48
 ACHE
Dengue fever, unspecified
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D2Z
 DRD3
Human immunodeficiency virus disease without mention of tuberculosis or malaria
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C62
 HTR3A
Ebola virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D60.01
 ACHE

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group