• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Alhagi Maurorum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATGCCTTACGTGCACAGACCGACCTGCGAACCTGTTTTGAATGCTTGCGTAGGGGTGGTTCGGGGTGTTAAAACTCCCCGTCCTCCCTTGAGAGGTAGGAGGGGGGCATGTAGCGTGCTCCCTTGCCTGCCCAAACCAAAACCCCGGCGCTGGCTGCGCCAAGGAATTGAAATTCGTTCGGGCGCCCCCCATAATGGTGCTCCCCTATGGGTGGTGCTTTGACACGTTCTGTGTAACAATAGAGAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCAGTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGTATCGTTGCTCGATGCCAATTGCCTCGTGGTAGGTGTTGTGCAGGGCGAATGCTGGCTTCCCGTGAGCGCCCGTGTCTCACGGTTGGCTGAAATCTAGGTCCTTGGTAGGTTGTGTGCCTTGATCGACGGTGGTTGTGCGACCCACGAGACGTGTCGGGCACCGGCTCTACCGGGTTTGGCCTTTGCGGCCCAAATGCGTCTTTGAACGCTCGTGA

Click for details-----ITS1

TCGATGCCTTACGTGCACAGACCGACCTGCGAACCTGTTTTGAATGCTTGCGTAGGGGTGGTTCGGGGTGTTAAAACTCCCCGTCCTCCCTTGAGAGGTAGGAGGGGGGCATGTAGCGTGCTCCCTTGCCTGCCCAAACCAAAACCCCGGCGCTGGCTGCGCCAAGGAATTGAAATTCGTTCGGGCGCCCCCCATAATGGTGCTCCCCTATGGGTGGTGCTTTGACACGTTCTGTGTAACAATAGAGAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO22283
Plant Latin Name: Alhagi Maurorum
Taxonomy Genus: Alhagi
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 47037
Plant-of-the-World-Online: 473473-1

Used in Medicines

Country/Region:
Jordan; Israel; Lebanon; Turkmenistan; India

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Ayurveda; Siddha


Medicinal Functions:

Diaphoretic; Diuretic; Expectorant; Laxative

Geographical Distribution

Turkey; Afghanistan; Israel; Australia; Iran; Turkmenistan; Pakistan; Kazakhstan; South Africa; India; Saudi Arabia; United States; Tajikistan; Jordan; Uzbekistan; Kuwait; Lebanon; Iraq; Cyprus; Russia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

113 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


66 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

24 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98663

Ingredient ID: NPC94581

Ingredient ID: NPC94337

Ingredient ID: NPC93157

Ingredient ID: NPC92867

Ingredient ID: NPC92793

Ingredient ID: NPC92348

Ingredient ID: NPC86893

Ingredient ID: NPC85338

Ingredient ID: NPC79303

Ingredient ID: NPC77040

Ingredient ID: NPC7151

Ingredient ID: NPC66770

Ingredient ID: NPC66252

Ingredient ID: NPC63584

Ingredient ID: NPC62192

Ingredient ID: NPC57114

Ingredient ID: NPC53069

Ingredient ID: NPC52692

Ingredient ID: NPC50905

Ingredient ID: NPC48915

Ingredient ID: NPC42424

Ingredient ID: NPC41476

Ingredient ID: NPC40848

Ingredient ID: NPC37315

Ingredient ID: NPC36765

Ingredient ID: NPC35314

Ingredient ID: NPC3477

Ingredient ID: NPC308311

Ingredient ID: NPC30784

Ingredient ID: NPC306270

Ingredient ID: NPC305244

Ingredient ID: NPC297587

Ingredient ID: NPC28705

Ingredient ID: NPC284261

Ingredient ID: NPC282670

Ingredient ID: NPC281388

Ingredient ID: NPC280443

Ingredient ID: NPC273589

Ingredient ID: NPC270452

Ingredient ID: NPC265526

Ingredient ID: NPC264617

Ingredient ID: NPC262641

Ingredient ID: NPC262410

Ingredient ID: NPC260526

Ingredient ID: NPC259588

Ingredient ID: NPC258037

Ingredient ID: NPC254212

Ingredient ID: NPC254121

Ingredient ID: NPC248213

Ingredient ID: NPC244471

Ingredient ID: NPC239770

Ingredient ID: NPC236287

Ingredient ID: NPC234709

Ingredient ID: NPC231284

Ingredient ID: NPC229857

Ingredient ID: NPC225524

Ingredient ID: NPC2238

Ingredient ID: NPC223588

Ingredient ID: NPC223140

Ingredient ID: NPC221104

Ingredient ID: NPC220705

Ingredient ID: NPC220440

Ingredient ID: NPC219953

Ingredient ID: NPC217582

Ingredient ID: NPC217091

Ingredient ID: NPC210915

Ingredient ID: NPC209043

Ingredient ID: NPC195810

Ingredient ID: NPC193968

Ingredient ID: NPC185226

Ingredient ID: NPC184548

Ingredient ID: NPC184170

Ingredient ID: NPC182080

Ingredient ID: NPC178881

Ingredient ID: NPC178507

Ingredient ID: NPC176130

Ingredient ID: NPC174513

Ingredient ID: NPC172259

Ingredient ID: NPC171630

Ingredient ID: NPC171572

Ingredient ID: NPC17031

Ingredient ID: NPC168619

Ingredient ID: NPC1682

Ingredient ID: NPC165578

Ingredient ID: NPC165550

Ingredient ID: NPC161923

Ingredient ID: NPC159181

Ingredient ID: NPC157168

Ingredient ID: NPC156961

Ingredient ID: NPC156654

Ingredient ID: NPC155847

Ingredient ID: NPC151143

Ingredient ID: NPC149702

Ingredient ID: NPC149423

Ingredient ID: NPC146122

Ingredient ID: NPC145726

Ingredient ID: NPC143928

Ingredient ID: NPC138362

Ingredient ID: NPC137777

Ingredient ID: NPC136671

Ingredient ID: NPC135139

Ingredient ID: NPC133014

Ingredient ID: NPC132784

Ingredient ID: NPC130833

Ingredient ID: NPC126446

Ingredient ID: NPC125865

Ingredient ID: NPC124822

Ingredient ID: NPC123017

Ingredient ID: NPC111242

Ingredient ID: NPC109592

Ingredient ID: NPC106361

Ingredient ID: NPC103382