• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ficus Carica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGTTCAAGGTTTTCCGTCGTGTGAACCTGCGGAAGCCCGCTCATCGGGATTTGTTTGTGAACCGGCTGACTTAAAGGTTAACGGCTTTCGAGGGGGGCGAGGGGCGCGAACACAACCAAGAAAGTCCTCGCCGGGTGCTTGTGGCCCCGCCCCTCGCCCCCGGCACCAAACGAACCCCGGCGCGGAATGCGTCAAGGAAAGACAACGAGACGATCCCCGCCATCGAGGCCCCGGGAACGGTGACTCTGCCTCGGTGGTCGCTTCGGGATCGGTTTTTAGTATGAAGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGTCGAGGGCACGTCTGCCTGGGCGTCACACGTCGTTGCCCGCCCGAACCCCCGTCCCGCTCCTAGCCGGGCGAGTGGGGACTGTGTGGGGGGGGCGGATGATGACCTCCCGTGCGTGCTTTGACCCGCGGTTGGTCCAAAAACCGAGTCCCCTGTCACGTCGTCTTGGCAACAGGTAGTCGATCATTCGGTGCCGCCTCCTCTGCGTCGGACACGCATCGGGTTCCGACAGACCCCAATCACCGTAGAGTAGCGCTTCGAGTGAGCAAACTTATTTACAGGGCGGGGGCCTACCCGCTGAGGTTTTAAGAAATAAAGCG

Click for details-----ITS1

TTTATGTTTTTTCTCTAGTGACGTACGCATGGATCATTCGTCGCAACCCTGCTCCAGCAGTAGAGACCTCGCGAACACGTTTCGACACTCGAGGGGTGACGAGGGGCGCGAACACGCCCCGTACCCTCCTTCTTCTGGGTGCTTGTGGCTCCGCCCCCTCGCCCCCGGCACCAAACGAAACCCCGGCGCGGAATGCGTCAAGGAAAGACAACGAGACGATCCCCGCCATCGAGGCCCCGGGAACGGTGACTCTGCCTCGGTGGTCGCTTCGGGATCGGTTTTTAGTATGAAGAA

Click for details-----ITS2

GTCGTTGCCCCCCCGGACCCCCGTCCCGCTCCTAGCCGGGCGAGTGGGGGACTGTGTGGGGGGGGCGGATGATGACCCTCCCGTGCGTGCTGGTCAGGATATTGTCGAAACCTGCCCAGCAGAGAGACCCGCGAACACGTTACAGACTTTGACCCGCGGTTGGTCCAAAAACCGAGTCCCCTGTCACGTCGTCTTGGCAACAGGTAGTCGATCATTCGGTGCCGCCGCCACGTGCGTCGGACACGCATCGGGACTCCGACAGACCCCAATGCGCCCGTCACGGGTGCCTCCACCGCTTTCGCCAGTTCCCCGAC
Taxonomic Information

Plant ID: NPO22234
Plant Latin Name: Ficus Carica
Taxonomy Genus: Ficus
Taxonomy Family: Moraceae

Plant External Links:

NCBI TaxonomyDB: 3494
Plant-of-the-World-Online: 852556-1

Used in Medicines

Country/Region:
Turkey; Israel; Italy; Turkmenistan; India; Indonesia; Lebanon; China; Spain

Traditional Medicine System:
Indian Folk; TCM; Unani; Ayurveda; Siddha


Medicinal Functions:

Cancer; Demulcent; Digestive; Emollient; Galactogogue; Laxative; Pectoral; Stings; Stomachic; Tonic; Warts

Geographical Distribution

Turkey; Afghanistan; Italy; Bangladesh; Lebanon; France; Somalia; Peru; Turkmenistan; Israel; Iran; Algeria; El Salvador; Cape Verde; China; Iraq; Spain; Eritrea; Libya; Oman; Indonesia; Saudi Arabia; Mauritius; Morocco; Switzerland; New Zealand; Yemen; Russia; Bulgaria; United States; Albania; Portugal; Chad; Mexico; Egypt; Tajikistan; South Africa; India; United Kingdom; Tunisia; Austria; Greece; Hungary; Niger; Cyprus

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

177 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


139 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

91 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97735

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC86381

Ingredient ID: NPC85813

Ingredient ID: NPC85446

Ingredient ID: NPC836

Ingredient ID: NPC78500

Ingredient ID: NPC75204

Ingredient ID: NPC74539

Ingredient ID: NPC74250

Ingredient ID: NPC71853

Ingredient ID: NPC70450

Ingredient ID: NPC69445

Ingredient ID: NPC68889

Ingredient ID: NPC68873

Ingredient ID: NPC68612

Ingredient ID: NPC68114

Ingredient ID: NPC63772

Ingredient ID: NPC62045

Ingredient ID: NPC61927

Ingredient ID: NPC61504

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC59035

Ingredient ID: NPC58478

Ingredient ID: NPC58190

Ingredient ID: NPC5642

Ingredient ID: NPC55412

Ingredient ID: NPC52955

Ingredient ID: NPC51146

Ingredient ID: NPC50345

Ingredient ID: NPC49151

Ingredient ID: NPC491218

Ingredient ID: NPC490427

Ingredient ID: NPC490425

Ingredient ID: NPC490424

Ingredient ID: NPC490338

Ingredient ID: NPC490334

Ingredient ID: NPC489948

Ingredient ID: NPC489907

Ingredient ID: NPC48623

Ingredient ID: NPC475308

Ingredient ID: NPC475235

Ingredient ID: NPC46947

Ingredient ID: NPC46496

Ingredient ID: NPC45960

Ingredient ID: NPC424

Ingredient ID: NPC41489

Ingredient ID: NPC3292

Ingredient ID: NPC328447

Ingredient ID: NPC32279

Ingredient ID: NPC322171

Ingredient ID: NPC32082

Ingredient ID: NPC320489

Ingredient ID: NPC317120

Ingredient ID: NPC314329

Ingredient ID: NPC313955

Ingredient ID: NPC311832

Ingredient ID: NPC308691

Ingredient ID: NPC301696

Ingredient ID: NPC301583

Ingredient ID: NPC296256

Ingredient ID: NPC295644

Ingredient ID: NPC295389

Ingredient ID: NPC294548

Ingredient ID: NPC291517

Ingredient ID: NPC290598

Ingredient ID: NPC290563

Ingredient ID: NPC290319

Ingredient ID: NPC289536

Ingredient ID: NPC285067

Ingredient ID: NPC283682

Ingredient ID: NPC281686

Ingredient ID: NPC280749

Ingredient ID: NPC28002

Ingredient ID: NPC279026

Ingredient ID: NPC278310

Ingredient ID: NPC272614

Ingredient ID: NPC271027

Ingredient ID: NPC270334

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC26906

Ingredient ID: NPC266441

Ingredient ID: NPC265800

Ingredient ID: NPC262505

Ingredient ID: NPC261831

Ingredient ID: NPC261080

Ingredient ID: NPC259134

Ingredient ID: NPC257124

Ingredient ID: NPC253936

Ingredient ID: NPC252843

Ingredient ID: NPC245187

Ingredient ID: NPC242580

Ingredient ID: NPC240492

Ingredient ID: NPC237812

Ingredient ID: NPC236579

Ingredient ID: NPC234084

Ingredient ID: NPC23145

Ingredient ID: NPC229786

Ingredient ID: NPC229253

Ingredient ID: NPC228776

Ingredient ID: NPC227037

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC224651

Ingredient ID: NPC219876

Ingredient ID: NPC219143

Ingredient ID: NPC217226

Ingredient ID: NPC214067

Ingredient ID: NPC213876

Ingredient ID: NPC213449

Ingredient ID: NPC209971

Ingredient ID: NPC208793

Ingredient ID: NPC208620

Ingredient ID: NPC203468

Ingredient ID: NPC202189

Ingredient ID: NPC201844

Ingredient ID: NPC201622

Ingredient ID: NPC201182

Ingredient ID: NPC200559

Ingredient ID: NPC199072

Ingredient ID: NPC198816

Ingredient ID: NPC198031

Ingredient ID: NPC196021

Ingredient ID: NPC194458

Ingredient ID: NPC192402

Ingredient ID: NPC190771

Ingredient ID: NPC189436

Ingredient ID: NPC187770

Ingredient ID: NPC186266

Ingredient ID: NPC185755

Ingredient ID: NPC184520

Ingredient ID: NPC182840

Ingredient ID: NPC18205

Ingredient ID: NPC179694

Ingredient ID: NPC178638

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC176017

Ingredient ID: NPC175987

Ingredient ID: NPC175342

Ingredient ID: NPC174246

Ingredient ID: NPC170331

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC164230

Ingredient ID: NPC162089

Ingredient ID: NPC160924

Ingredient ID: NPC159858

Ingredient ID: NPC159177

Ingredient ID: NPC15663

Ingredient ID: NPC155185

Ingredient ID: NPC154186

Ingredient ID: NPC153958

Ingredient ID: NPC152759

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC148825

Ingredient ID: NPC147983

Ingredient ID: NPC144403

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC130683

Ingredient ID: NPC127122

Ingredient ID: NPC126681

Ingredient ID: NPC12455

Ingredient ID: NPC124165

Ingredient ID: NPC120649

Ingredient ID: NPC119271

Ingredient ID: NPC11433

Ingredient ID: NPC114325

Ingredient ID: NPC112890

Ingredient ID: NPC10722

Ingredient ID: NPC103035

Ingredient ID: NPC10241