• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hordeum Vulgare


Example Image
PLANiTS DNA barcode

Click for details-----ITS

ATTGTCGTGACCCTGACCAAAACAGACCGTGCTCGCGTCATCCAATCCTCCGACGATGGCATTGTTCGTCGTTCGGCCAATTCCTCGACCGCCTCCACTCCTAGGAGCGGGGGCTCGTGGTAAAAGAACCCACGGCGCCGAAGGCGTCAAGGAACACTGTGCCTAACCCGGGGAGATGGCTAGCTTGCTGGTCGTCACCTGTGTTGCAAATATATTTAATCCACACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACCTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCCAAAACACGCTCCCAACCACCCTCTTCGGGAATTGGGATGCGGCATATGGTCCCTCGTCCTGCAAGGGGCGGTGGGCCGAAGATCGGGCTGCCGGCGTACCGCGTCGGACACAGCGCATGGTGGGCGTCCTTGCTTTATCAATGCAGTGCATCCGACGCGTAGACGGCATCATGGCCTCGAAACGACCCATCGAACGAAGTGCACGTCGCTTCGACCGCGACCCCA

Click for details-----ITS1

TCGTGACCCTGACCAAAACAGACCGTGCTCGCGTCATCCAATCCTCCGACGATGGCATTGTTCGTCGTTCGGCCAATTCCTCGACCGCCTCCACTCCTAAGAGCGGGGCTCGTGGTAAAAGAACCCACGGCGCGAAGGGCGTCAAGGAACACTGTGCCTAACCCGGGAAGATGGCTAGCTTGCTGGTCGTCACCTGTGTTGCAAATATATTTAATCCACA

Click for details-----ITS2

CGAAAACACACTCCCAACCACCCTCTTCGGGAATTGGGATGCGGCATATGGTCCCTCGTCCTACAAGGGGCGGTGGGACGAAGATCGGGCTGCCAGCGTACCGCGCCGAAAAAATATCGCATGGTGGGCGTTCTCGCTTTATCAATGTAGTGCATCCGACGCGTAGACGACATCATGGTCTCGAAACGACCCAGCGAACGAAGTGCACGTTGCTTCGACC
Taxonomic Information

Plant ID: NPO22132
Plant Latin Name: Hordeum Vulgare
Taxonomy Genus: Hordeum
Taxonomy Family: Poaceae

Plant External Links:

NCBI TaxonomyDB: 4513
Plant-of-the-World-Online: 405391-1

Used in Medicines

Country/Region:
Turkey; Afghanistan; Madagascar; Italy; South Africa; India; United States; Zimbabwe; Jordan; Swaziland; Angola; Argentina; China; South Korea

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; Kampo; TCM


Medicinal Functions:

Abortifacient; Cancer; Carminative; Demulcent; Digestive; Diuretic; Emollient; Expectorant; Febrifuge; Galactofuge; Hypoglycaemic; Lenitive; Nutritive; Poultice; Stomachic

Geographical Distribution

Canada; Turkmenistan; Ethiopia; Swaziland; Argentina; Bolivia; Saudi Arabia; Guatemala; Germany; Spain; Netherlands; Oman; Greenland; New Zealand; Yemen; Pakistan; Albania; India; South Korea; Tajikistan; Turkey; Afghanistan; Bangladesh; Mongolia; France; Rwanda; Peru; Norway; Cuba; China; Dominican Republic; Ukraine; Libya; Finland; United States; Sweden; Belarus; Russia; Romania; Angola; Portugal; South Africa; Cyprus; Austria; Vietnam; Japan; Niger; Brazil; Kuwait; Nigeria; Ecuador; Australia; Iran; Algeria; El Salvador; Chile; Belgium; Haiti; Iraq; Denmark; Poland; Morocco; Switzerland; Chad; Uruguay; Uzbekistan; Tunisia; Colombia; Taiwan; Fiji; Madagascar; Italy; Nepal; Iceland; Zimbabwe; Jordan; Kazakhstan; Mauritania; New Caledonia; Hungary; Honduras; Myanmar; Mexico; Egypt; United Kingdom; Sri Lanka

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

137 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


103 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

91 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9848

Ingredient ID: NPC96102

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC93342

Ingredient ID: NPC86555

Ingredient ID: NPC85813

Ingredient ID: NPC85338

Ingredient ID: NPC78312

Ingredient ID: NPC74599

Ingredient ID: NPC63951

Ingredient ID: NPC62045

Ingredient ID: NPC60120

Ingredient ID: NPC59650

Ingredient ID: NPC58190

Ingredient ID: NPC55412

Ingredient ID: NPC52197

Ingredient ID: NPC50934

Ingredient ID: NPC490409

Ingredient ID: NPC490332

Ingredient ID: NPC490321

Ingredient ID: NPC490288

Ingredient ID: NPC489928

Ingredient ID: NPC489907

Ingredient ID: NPC43347

Ingredient ID: NPC424

Ingredient ID: NPC39426

Ingredient ID: NPC34908

Ingredient ID: NPC33666

Ingredient ID: NPC3343

Ingredient ID: NPC328447

Ingredient ID: NPC325153

Ingredient ID: NPC322254

Ingredient ID: NPC317120

Ingredient ID: NPC3165

Ingredient ID: NPC313851

Ingredient ID: NPC309330

Ingredient ID: NPC303782

Ingredient ID: NPC300059

Ingredient ID: NPC295644

Ingredient ID: NPC294548

Ingredient ID: NPC294186

Ingredient ID: NPC293628

Ingredient ID: NPC291473

Ingredient ID: NPC289381

Ingredient ID: NPC281686

Ingredient ID: NPC281517

Ingredient ID: NPC28081

Ingredient ID: NPC27836

Ingredient ID: NPC27633

Ingredient ID: NPC273019

Ingredient ID: NPC272614

Ingredient ID: NPC270931

Ingredient ID: NPC270077

Ingredient ID: NPC269919

Ingredient ID: NPC265319

Ingredient ID: NPC261831

Ingredient ID: NPC258605

Ingredient ID: NPC248681

Ingredient ID: NPC245346

Ingredient ID: NPC24407

Ingredient ID: NPC242580

Ingredient ID: NPC23962

Ingredient ID: NPC237812

Ingredient ID: NPC230085

Ingredient ID: NPC226453

Ingredient ID: NPC226340

Ingredient ID: NPC225783

Ingredient ID: NPC225665

Ingredient ID: NPC222729

Ingredient ID: NPC220765

Ingredient ID: NPC22014

Ingredient ID: NPC219876

Ingredient ID: NPC216077

Ingredient ID: NPC21157

Ingredient ID: NPC210267

Ingredient ID: NPC208793

Ingredient ID: NPC207554

Ingredient ID: NPC205478

Ingredient ID: NPC205407

Ingredient ID: NPC203468

Ingredient ID: NPC201844

Ingredient ID: NPC201284

Ingredient ID: NPC199072

Ingredient ID: NPC198215

Ingredient ID: NPC198196

Ingredient ID: NPC197087

Ingredient ID: NPC193989

Ingredient ID: NPC193154

Ingredient ID: NPC192032

Ingredient ID: NPC189436

Ingredient ID: NPC188428

Ingredient ID: NPC187907

Ingredient ID: NPC187770

Ingredient ID: NPC185858

Ingredient ID: NPC185755

Ingredient ID: NPC184416

Ingredient ID: NPC178868

Ingredient ID: NPC17810

Ingredient ID: NPC175048

Ingredient ID: NPC174246

Ingredient ID: NPC170331

Ingredient ID: NPC169056

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC166313

Ingredient ID: NPC166018

Ingredient ID: NPC158079

Ingredient ID: NPC155847

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC147983

Ingredient ID: NPC147310

Ingredient ID: NPC146422

Ingredient ID: NPC141765

Ingredient ID: NPC14079

Ingredient ID: NPC139037

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC135539

Ingredient ID: NPC133183

Ingredient ID: NPC130683

Ingredient ID: NPC126681

Ingredient ID: NPC126409

Ingredient ID: NPC125732

Ingredient ID: NPC125731

Ingredient ID: NPC119368

Ingredient ID: NPC118429

Ingredient ID: NPC115723

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC11280

Ingredient ID: NPC111897

Ingredient ID: NPC111275

Ingredient ID: NPC110126

Ingredient ID: NPC100551

Ingredient ID: NPC100128