• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Solanum Nigrum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTGTCGAAACCTGCAAAGCAGAACGACCCGCGAACACGTTCAAACACCGGGGGAGCCGCGCGGCGTGGGTGCTTCGGCGCCCCTCCGCGCGTGTTCCCTCTCGTCCCCGGCTCGTTCCGGGCGACTAACGAACCCCGGCGCGGAAAGCGCCAAGGAATACTTAAATTGAGAGCCCTCCCCTCGCGCCCCGTCCGCGGAGTGTGCGGGGGGATGCGCGCTTCTTTTGAAACCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCGCACGCCGCAAGGCGTCGTGGGGCGGATACTGGCCTCCCGTGCGCCTCGAGCTCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTTTGTGTCGCGGCTACAGCCCGTCGCGCGTCCGGACTCCAGACCCTCTAAGCGCTTAGGCGCTCCGACCGCGACCCCA

Click for details-----ITS1

GAACTGCAAGCGACGACCCGCGAACACGTTCAAACACCGGGGGAGCAGCGCGGCGCGGGTGCTTCGGCGTCCCTCCGCGCGCGTTCCCCCTCGTCGCCGGCTCGTTCGGGGCGACTAACGAACCGCGGCGCGAAAAGCGCCAAGGAATACTTAAACTGAGAGCCCTCCCCTCGCGCCCCGTCCGCGGAGTGTGCGGGGGGATGCGCGCTTCTTTTGAAACCAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCGCACGCCGCAAGGCGTCGTGGGGCGGATACTGGCCTCCCGTGCGCCTCGAGCTCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAACTCAACTCTCTTTGTGTCGCGGCTACAGCCCGTCGCGCGTCCGGACTCCAGACCCTCTAAGCGCTTAGGCGCTCCGACCGCGACCCCAGGTCAGGCGGATACCCCG
Taxonomic Information

Plant ID: NPO2211
Plant Latin Name: Solanum Nigrum
Taxonomy Genus: Solanum
Taxonomy Family: Solanaceae

Plant External Links:

NCBI TaxonomyDB: 4112
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Israel; Indonesia; Italy; Mexico; Guinea; Tanzania; Finland; India; Malaysia; Rwanda; Jordan; Vietnam; Thailand; Kenya; South Korea; China; Philippines; Bulgaria

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Antiperiodic; Antiphlogistic; Antipsoriatic; Diaphoretic; Diuretic; Emollient; Febrifuge; Narcotic; Purgative; Sedative

Geographical Distribution

Israel; Indonesia; Italy; Mexico; Guinea; Philippines; Finland; India; Malaysia; Rwanda; China; Vietnam; Kenya; Jordan; South Korea; Tanzania; Thailand; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

118 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


58 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

63 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99572

Ingredient ID: NPC95920

Ingredient ID: NPC91603

Ingredient ID: NPC90354

Ingredient ID: NPC88803

Ingredient ID: NPC88369

Ingredient ID: NPC87705

Ingredient ID: NPC85001

Ingredient ID: NPC81010

Ingredient ID: NPC79943

Ingredient ID: NPC76336

Ingredient ID: NPC70744

Ingredient ID: NPC7040

Ingredient ID: NPC68589

Ingredient ID: NPC62469

Ingredient ID: NPC61477

Ingredient ID: NPC50898

Ingredient ID: NPC48886

Ingredient ID: NPC42760

Ingredient ID: NPC41590

Ingredient ID: NPC40432

Ingredient ID: NPC38069

Ingredient ID: NPC35530

Ingredient ID: NPC34103

Ingredient ID: NPC32977

Ingredient ID: NPC3295

Ingredient ID: NPC327436

Ingredient ID: NPC326355

Ingredient ID: NPC32441

Ingredient ID: NPC312800

Ingredient ID: NPC309080

Ingredient ID: NPC30856

Ingredient ID: NPC307270

Ingredient ID: NPC302950

Ingredient ID: NPC302857

Ingredient ID: NPC300845

Ingredient ID: NPC29883

Ingredient ID: NPC294902

Ingredient ID: NPC294513

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC284104

Ingredient ID: NPC279121

Ingredient ID: NPC273855

Ingredient ID: NPC272113

Ingredient ID: NPC264752

Ingredient ID: NPC261619

Ingredient ID: NPC258130

Ingredient ID: NPC257182

Ingredient ID: NPC25455

Ingredient ID: NPC253645

Ingredient ID: NPC252126

Ingredient ID: NPC250781

Ingredient ID: NPC250436

Ingredient ID: NPC2499

Ingredient ID: NPC24532

Ingredient ID: NPC244726

Ingredient ID: NPC242770

Ingredient ID: NPC232469

Ingredient ID: NPC230301

Ingredient ID: NPC22861

Ingredient ID: NPC228346

Ingredient ID: NPC225710

Ingredient ID: NPC225416

Ingredient ID: NPC223695

Ingredient ID: NPC221584

Ingredient ID: NPC221568

Ingredient ID: NPC220825

Ingredient ID: NPC219876

Ingredient ID: NPC20791

Ingredient ID: NPC204025

Ingredient ID: NPC201817

Ingredient ID: NPC196776

Ingredient ID: NPC194076

Ingredient ID: NPC186528

Ingredient ID: NPC180377

Ingredient ID: NPC180256

Ingredient ID: NPC179694

Ingredient ID: NPC176740

Ingredient ID: NPC173016

Ingredient ID: NPC169749

Ingredient ID: NPC167976

Ingredient ID: NPC165967

Ingredient ID: NPC165159

Ingredient ID: NPC161557

Ingredient ID: NPC1591

Ingredient ID: NPC158079

Ingredient ID: NPC156654

Ingredient ID: NPC15658

Ingredient ID: NPC156461

Ingredient ID: NPC155185

Ingredient ID: NPC153572

Ingredient ID: NPC15249

Ingredient ID: NPC151297

Ingredient ID: NPC150324

Ingredient ID: NPC150057

Ingredient ID: NPC147835

Ingredient ID: NPC147753

Ingredient ID: NPC142753

Ingredient ID: NPC141765

Ingredient ID: NPC139936

Ingredient ID: NPC139665

Ingredient ID: NPC13792

Ingredient ID: NPC1347

Ingredient ID: NPC132787

Ingredient ID: NPC1285

Ingredient ID: NPC126681

Ingredient ID: NPC126409

Ingredient ID: NPC126029

Ingredient ID: NPC122819

Ingredient ID: NPC116775

Ingredient ID: NPC115723

Ingredient ID: NPC115207

Ingredient ID: NPC111888

Ingredient ID: NPC110990

Ingredient ID: NPC110899

Ingredient ID: NPC1075

Ingredient ID: NPC104983