• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hypericum Japonicum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTGAACCTGCGGAAGGATCATTGTCGAAACTTGCAAAAGAAGACCCGTGAACTAGTTATCAACATGTGGGGGGAGTGTTGGGAGATATCCCTTATAGCTCCTTCGTGCCAGTGGTGGGTAATCGTGTCGTTATACCGGCATGATTGACCAACATCTGGACAAGCTAACCAACCCCGGCGCGGCATGCGCCAAGGAACTTTGCAATAAATGTGGAAAACGCTAGGTCGTTCCGAAAATCGGATAAAGCGGCCGTGTTGTGGACCACTTCTTCATTACAAAACGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCTTGGCCAAGGGCACGTCTGCCTGGGTGTCACACATCGTCCCCACCGAAACAAATGCTCCTTGTAGGTGTTTGGTAAGAGGATGGGCGGATAATGGTCTCCCGTGCGCGGTTGCTCGCGGTTGGCCGAAAAATAAGTTCCTGGTGATAGCAAGCCATGACCAGCGGTGGTTGAAAGACCCTCGATGGGTGTCGTGAGAACTTGCATCGCATGTTGGGAGATTCTGACCTTGATCGTGTTTGAGCATATATCAAACACTCATGAA

Click for details-----ITS1

GTGAACCTGCGGAAGGATCATTGTCGAAACTTGCAAAAGAAGACCCGTGAACTAGTTATCAACATGTGGGGGGAGTGTTGGGAGATATCCCTTATAGCTCCTTCGTGCCAGTGGTGGGTAATCGTGTCGTTATACCGGCATGATTGACCAACATCTGGACAAGCTAACCAACCCCGGCGCGGCATGCGCCAAGGAACTTTGCAATAAATGTGGAAAACGCTAGGTCGTTCCGAAAATCGGATAAAGCGGCCGTGTTGTGGACCACTTCTTCATTACAAAA

Click for details-----ITS2

ATCGTCCCCACCGAAACAAATGCTCCTTGTAGGTGTTTGGTAAGAGGATGGGCGGATAATGGTCTCCCGTGCGCGGTTGCTCGCGGTTGGCCGAAAAATGAGTTCCTGGTGATAGCAAGCCATGACCAGCGGTGGTTGAAAGACCCTCGATGGGTGTCGTGAGAACTTGCATCGCATGTTGGGAGATTCTGACCTTGATCGTGTTTGAGCATATATCAAACACTCATGAAGTGACCCCAGGTCAGGCGGG
Taxonomic Information

Plant ID: NPO21963
Plant Latin Name: Hypericum Japonicum
Taxonomy Genus: Hypericum
Taxonomy Family: Hypericaceae

Plant External Links:

NCBI TaxonomyDB: 282542
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Guinea; Vietnam; China; India

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Antiphlogistic; Depurative; Febrifuge; Vulnerary

Geographical Distribution

Guinea; Vietnam; China; India

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

148 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


87 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

84 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC88924

Ingredient ID: NPC88789

Ingredient ID: NPC86642

Ingredient ID: NPC85813

Ingredient ID: NPC81775

Ingredient ID: NPC80981

Ingredient ID: NPC7965

Ingredient ID: NPC78377

Ingredient ID: NPC71639

Ingredient ID: NPC67508

Ingredient ID: NPC66117

Ingredient ID: NPC64176

Ingredient ID: NPC62290

Ingredient ID: NPC61558

Ingredient ID: NPC57897

Ingredient ID: NPC57788

Ingredient ID: NPC54321

Ingredient ID: NPC54145

Ingredient ID: NPC5322

Ingredient ID: NPC51700

Ingredient ID: NPC49168

Ingredient ID: NPC483027

Ingredient ID: NPC483026

Ingredient ID: NPC483025

Ingredient ID: NPC483024

Ingredient ID: NPC483023

Ingredient ID: NPC483022

Ingredient ID: NPC483021

Ingredient ID: NPC483020

Ingredient ID: NPC483019

Ingredient ID: NPC483018

Ingredient ID: NPC483017

Ingredient ID: NPC483016

Ingredient ID: NPC483015

Ingredient ID: NPC47844

Ingredient ID: NPC47135

Ingredient ID: NPC46941

Ingredient ID: NPC43276

Ingredient ID: NPC41163

Ingredient ID: NPC40018

Ingredient ID: NPC34429

Ingredient ID: NPC321549

Ingredient ID: NPC317111

Ingredient ID: NPC310562

Ingredient ID: NPC304838

Ingredient ID: NPC304072

Ingredient ID: NPC302857

Ingredient ID: NPC301398

Ingredient ID: NPC30069

Ingredient ID: NPC299326

Ingredient ID: NPC294591

Ingredient ID: NPC288589

Ingredient ID: NPC282974

Ingredient ID: NPC282694

Ingredient ID: NPC281131

Ingredient ID: NPC275463

Ingredient ID: NPC27532

Ingredient ID: NPC275122

Ingredient ID: NPC274613

Ingredient ID: NPC273326

Ingredient ID: NPC272651

Ingredient ID: NPC27202

Ingredient ID: NPC27133

Ingredient ID: NPC270783

Ingredient ID: NPC266447

Ingredient ID: NPC266396

Ingredient ID: NPC264317

Ingredient ID: NPC262911

Ingredient ID: NPC262505

Ingredient ID: NPC254696

Ingredient ID: NPC254284

Ingredient ID: NPC254199

Ingredient ID: NPC249040

Ingredient ID: NPC246180

Ingredient ID: NPC244705

Ingredient ID: NPC243728

Ingredient ID: NPC242580

Ingredient ID: NPC238376

Ingredient ID: NPC236761

Ingredient ID: NPC236202

Ingredient ID: NPC233443

Ingredient ID: NPC23158

Ingredient ID: NPC230920

Ingredient ID: NPC230301

Ingredient ID: NPC227986

Ingredient ID: NPC224874

Ingredient ID: NPC22098

Ingredient ID: NPC218109

Ingredient ID: NPC215242

Ingredient ID: NPC213508

Ingredient ID: NPC210560

Ingredient ID: NPC20791

Ingredient ID: NPC207429

Ingredient ID: NPC204989

Ingredient ID: NPC204353

Ingredient ID: NPC202742

Ingredient ID: NPC20175

Ingredient ID: NPC199978

Ingredient ID: NPC199977

Ingredient ID: NPC198778

Ingredient ID: NPC197396

Ingredient ID: NPC196293

Ingredient ID: NPC194208

Ingredient ID: NPC1940

Ingredient ID: NPC192744

Ingredient ID: NPC190930

Ingredient ID: NPC181225

Ingredient ID: NPC179950

Ingredient ID: NPC178134

Ingredient ID: NPC176869

Ingredient ID: NPC173638

Ingredient ID: NPC172945

Ingredient ID: NPC171928

Ingredient ID: NPC170526

Ingredient ID: NPC167976

Ingredient ID: NPC166846

Ingredient ID: NPC165651

Ingredient ID: NPC164877

Ingredient ID: NPC164859

Ingredient ID: NPC164646

Ingredient ID: NPC161532

Ingredient ID: NPC156654

Ingredient ID: NPC155763

Ingredient ID: NPC154172

Ingredient ID: NPC151708

Ingredient ID: NPC149203

Ingredient ID: NPC14662

Ingredient ID: NPC143799

Ingredient ID: NPC142703

Ingredient ID: NPC140689

Ingredient ID: NPC139891

Ingredient ID: NPC138883

Ingredient ID: NPC137096

Ingredient ID: NPC135353

Ingredient ID: NPC135088

Ingredient ID: NPC134584

Ingredient ID: NPC134570

Ingredient ID: NPC133646

Ingredient ID: NPC125575

Ingredient ID: NPC123965

Ingredient ID: NPC123658

Ingredient ID: NPC113928

Ingredient ID: NPC113404

Ingredient ID: NPC110899

Ingredient ID: NPC108811

Ingredient ID: NPC106392

Ingredient ID: NPC106200

Ingredient ID: NPC101475