• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Alyxia Reinwardtii


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCCTCCCCCACCTCGTCCCCAAAATAGGGACGGCGAGCGTTGTTCGGGGAGCGCGGAAATTGGCCTCCCGTGCTAGCGTGCGGTTGGCCTAAACTCGAGTCCCTCGCTGCGGACGTCACGACAAGTGGTGGTTGAAATCGTCAACTCGAATGCAAGTTGTGCCACAACCCGCTGCGGAGCGGACTCTGGGACCCTTCAGCGATGCCCCTCTCGAGGAGCATTGCCACGA
Taxonomic Information

Plant ID: NPO21956
Plant Latin Name: Alyxia Reinwardtii
Taxonomy Genus: Alyxia
Taxonomy Family: Apocynaceae

Plant External Links:

NCBI TaxonomyDB: 403097
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; Indonesia

Traditional Medicine System:

Geographical Distribution

Thailand; Indonesia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

22 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


4 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

13 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC73855

Ingredient ID: NPC65333

Ingredient ID: NPC39834

Ingredient ID: NPC278348

Ingredient ID: NPC271744

Ingredient ID: NPC27124

Ingredient ID: NPC268342

Ingredient ID: NPC253491

Ingredient ID: NPC250436

Ingredient ID: NPC241162

Ingredient ID: NPC24031

Ingredient ID: NPC231644

Ingredient ID: NPC225710

Ingredient ID: NPC220825

Ingredient ID: NPC21209

Ingredient ID: NPC210632

Ingredient ID: NPC20791

Ingredient ID: NPC178134

Ingredient ID: NPC176740

Ingredient ID: NPC175118

Ingredient ID: NPC169749

Ingredient ID: NPC110899