• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Tarenaya Spinosa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCTTAAAATCCGAAAAGGAATAACTTGTGAACGCGTAATCACACATGCGGTGCGTGGGGACTTTAACCGGTTGTCACGCTCGCCTAGTCCGTAGGGTCATGTGCAATCAAATGAGTGCACACTCATTAGGCTGTACGTGGTTCTGTCGGAAATTCACAAAACCCCGGCGCAGAAAGCGTCAAGGACCATTCAACGAAACAGCTCACCCTGAATGCAGCCTTTTAGGTTCGTATTCGTGTGTGTTGCTGCGATCATAAGTCTAAAACGACTCTCGGCAACGGATATCKCGGCTCTCGCATCGATGAAGAACGAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCTAAGCCGTCAGGCCGAGGGCACGCTTGCCTGGGTGTCACGCATCGTCATCTCCCCCACCCGTCTAAGCTTTGCTTGGGTGATTACGGAGAAGGAGATTGGTCTCCCGTGTGTTACCGCACGCGGTTGGCCTAAAATCGAGACAAGGGGGCGCGAAGCACCTGATAAGCGGTGGTGTGTAGATGCCTCGTGCGAATGTCAGTTGCTTTCGTCCCGATTGAGTCTATGACCCTTTAAGTGTCGTTTGCGCGATTCTTTGAACGCGACCCCAGGTCAAGTGGGA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO21904
Plant Latin Name: Tarenaya Spinosa
Taxonomy Genus: Tarenaya
Taxonomy Family: Cleomaceae

Plant External Links:

NCBI TaxonomyDB: 228870
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Brazil; Indonesia

Traditional Medicine System:

Geographical Distribution

Brazil; Indonesia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

23 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


8 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98477

Ingredient ID: NPC73855

Ingredient ID: NPC41493

Ingredient ID: NPC35644

Ingredient ID: NPC312391

Ingredient ID: NPC282720

Ingredient ID: NPC275760

Ingredient ID: NPC240431

Ingredient ID: NPC227768

Ingredient ID: NPC217387

Ingredient ID: NPC213322

Ingredient ID: NPC20791

Ingredient ID: NPC173637

Ingredient ID: NPC169749

Ingredient ID: NPC169468

Ingredient ID: NPC138927

Ingredient ID: NPC119056

Ingredient ID: NPC116775

Ingredient ID: NPC113783

Ingredient ID: NPC111929

Ingredient ID: NPC110879

Ingredient ID: NPC107263

Ingredient ID: NPC101426