CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Isodon Megathyrsus

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCAAAGCAGACCGCGAACACGTTTCTAAAGCCATCCCCCGCCGCAGCGCGCGCACTCGTGCCGCGCTGCGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACTTAAATTTAGCGTCGGTCCCGCCCCGCATCCCGTTCGCGGGCCGTGCGGTGCGGAACGGGCGTCTATCGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCTCCCCCCCACCACTCTGGCGAGGGGGGGCGGATATTGGCCTCCCGTGCGCCTCGGCGTGCGGCCGGCCCAAATGCGATCCCCCGGCGACTCGCGTCGCGACAAGTGGTGGTTGAACATCTCAATCTCGCGTCTCGTCGTGCCGCCGAGCCATCCGTGGTGATCCGAACTATGACCCAACGGAGCTTGCTCCTTCGA

Click for details-----ITS1

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO21870
Plant Latin Name: Isodon Megathyrsus
Taxonomy Genus: Isodon
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 662919
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

9 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

7 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

5 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC77633

Ingredient ID: NPC475803

Ingredient ID: NPC299275

Ingredient ID: NPC243099

Ingredient ID: NPC226941

Ingredient ID: NPC215584

Ingredient ID: NPC202793

Ingredient ID: NPC14634

Ingredient ID: NPC134018

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Cytochrome P450	Cytochrome P450 family 2	CYP2D6	Cytochrome P450 2D6	P10635	CHEMBL289
Cytochrome P450	Cytochrome P450 family 3	CYP3A4	Cytochrome P450 3A4	P08684	CHEMBL340
Therapeutic Target	Protein Kinase	KIT	Stem cell growth factor receptor	P10721	CHEMBL1936
Therapeutic Target	Secreted protein	THPO	Thrombopoietin	P40225	CHEMBL1293256
Drug Transporter	SLC superfamily of solute carriers	SLC22A3	Solute carrier family 22 member 3	O75751	CHEMBL2073673
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transcription factor	PAX8	Paired box protein Pax-8	Q06710	CHEMBL2362980
Therapeutic Target	Unclassified protein	GMNN	Geminin	O75496	CHEMBL1293278

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	84

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT04264260	Evaluation the Palliative Effects of Colchicine on Primary Hepatic Malignant Tumors Unable to Receive Curative Treatment	cholangiocarcinoma	Colchicine (NPC226941)	NP level
NCT01005121	Colchicine for Diabetic Nephropathy	diabetic nephropathy	Colchicine (NPC226941)	NP level
NCT01399008	Safety/Efficacy Study to Evaluate of MBX-102 in Combination With Allopurinol in Gout Patients	gout	Colchicine (NPC226941)	NP level
NCT04324463	Anti-Coronavirus Therapies to Prevent Progression of Coronavirus Disease 2019 (COVID-19) Trial	COVID-19;severe acute respiratory syndrome	Colchicine (NPC226941)	NP level
NCT00128414	Study of Colchicine to Treat and Prevent Recurrent Pericarditis (First Episode)	pericarditis	Colchicine (NPC226941)	NP level
NCT04492358	Treatment for Moderate/Severe COVID-19 in a Fragile and Vulnerable Population, Admitted to a Geriatric Hospital Unit or in a Transicional Care Center	COVID-19	Colchicine (NPC226941)	NP level
NCT03048825	Colchicine and Spironolactone in Patients With MI / SYNERGY Stent Registry	Non-ST Elevation Myocardial Infarction;ST Elevation Myocardial Infarction	Colchicine (NPC226941)	NP level
NCT05503225	Colchicine Use in Intracranial Atherosclerotic Disease	atherosclerosis	Colchicine (NPC226941)	NP level
NCT04363437	COlchicine in Moderate-severe Hospitalized Patients Before ARDS to Treat COVID-19	COVID-19	Colchicine (NPC226941)	NP level
NCT01755949	Colchicine and CRP in Atrial Fibrillation and AF Ablation	atrial fibrillation	Colchicine (NPC226941)	NP level
NCT02162303	Colchicine in Vascular Inflammation Assessed With PET Imaging	vascular disease	Colchicine (NPC226941)	NP level
NCT00128427	Study of Colchicine to Prevent the Postpericardiotomy Syndrome	Postpericardiotomy Syndrome	Colchicine (NPC226941)	NP level
NCT04381936	Randomised Evaluation of COVID-19 Therapy	severe acute respiratory syndrome	Colchicine (NPC226941)	NP level
NCT05159219	Colchicine for the Prevention of Vascular Events After an Acute Intracerebral Hemorrhage	intracranial hemorrhage	Colchicine (NPC226941)	NP level
NCT04472611	Colchicine/Statins for the Prevention of COVID-19 Complications (COLSTAT) Trial	COVID-19	Colchicine (NPC226941)	NP level
NCT02176460	Colchicine for Symptom and Inflammation in Knee Osteoarthritis	osteoarthritis	Colchicine (NPC226941)	NP level
NCT04867226	Effectiveness of Colchicine Among Patients With COVID-19 Infection	COVID-19	Colchicine (NPC226941)	NP level
NCT04997551	Double Blind Randomized Clinical Trial of Use of Colchicine Added to Standard Treatment in Hospitalized With Covid-19	COVID-19	Colchicine (NPC226941)	NP level
NCT04756128	Impact of Colchicine and Low-dose Naltrexone on COVID-19	COVID-19	Colchicine (NPC226941)	NP level
NCT04539873	Impact of Colchicine in Hospitalized Colombian Patients With COVID-19	COVID-19	Colchicine (NPC226941)	NP level
NCT04355143	Colchicine to Reduce Cardiac Injury in COVID-19 (COLHEART-19)	COVID-19	Colchicine (NPC226941)	NP level
NCT00000577	Asthma Clinical Research Network (ACRN)	asthma;lung disease	Colchicine (NPC226941)	NP level
NCT03021343	Effect of Colchicine on the Incidence of Atrial Fibrillation in Open Heart Surgery Patients	cardiac arrhythmia	Colchicine (NPC226941)	NP level
NCT04516941	CorONa Virus edoxabaN ColchicinE (CONVINCE) COVID-19	COVID-19;severe acute respiratory syndrome	Colchicine (NPC226941)	NP level
NCT04392141	Colchicine Plus Phenolic Monoterpenes to Treat COVID-19	COVID-19	Colchicine (NPC226941)	NP level
NCT01481233	Oral Colchicine in Men With Castrate Resistant Prostate Cancer	prostate cancer	Colchicine (NPC226941)	NP level
NCT04762771	Colchicine for the Treatment of Cardiac Injury in Hospitalized Patients With COVID-19 (COLHEART-19)	COVID-19	Colchicine (NPC226941)	NP level
NCT04322682	Colchicine Coronavirus SARS-CoV2 Trial (COLCORONA)	COVID-19	Colchicine (NPC226941)	NP level
NCT03015831	Effect of Low Dose ColchiciNe on the InciDence of POAF	atrial fibrillation	Colchicine (NPC226941)	NP level
NCT01994226	Colchicine Or Naproxen Treatment for ACute gouT	gout	Colchicine (NPC226941)	NP level
NCT03156816	COlchicine for Left VEntricular Remodeling Treatment in Acute Myocardial Infarction	myocardial infarction	Colchicine (NPC226941)	NP level
NCT02330796	Bucillamine for the Treatment of Acute Gout Flare in Subjects With Moderate to Severe Gout	gout	Colchicine (NPC226941)	NP level
NCT05472337	Effect of Colchicine on Coronary Reperfusion in Patients With Acute Coronary Syndrome	acute coronary syndrome	Colchicine (NPC226941)	NP level
NCT02139046	Efficacy and Safety of Extended Release and Immediate Release Febuxostat in Participants With Gout	gout	Colchicine (NPC226941)	NP level
NCT02063997	Evaluate the Efficacy and Safety of Arhalofenate for Preventing Flares and Reducing Serum Uric Acid in Gout Patients	gout	Colchicine (NPC226941)	NP level
NCT00128453	Study of Colchicine to Treat Acute Pericarditis and Prevent Recurrences	pericarditis	Colchicine (NPC226941)	NP level
NCT05175274	Colchicine Use for Primary Prevention of Coronary Artery Disease	coronary artery disease	Colchicine (NPC226941)	NP level
NCT04008316	Efficacy of Colchicine to Prevent Skin Relapses in Adult's IgA Vasculitis	vasculitis	Colchicine (NPC226941)	NP level
NCT04322565	Colchicine Counteracting Inflammation in COVID-19 Pneumonia	coronavirus infectious disease;viral pneumonia	Colchicine (NPC226941)	NP level
NCT00004748	Low-Dose Oral Methotrexate Versus Colchicine for Primary Biliary Cirrhosis	primary biliary cirrhosis	Colchicine (NPC226941)	NP level
NCT02582190	COlchicine for the Prevention of Post Electrical Cardioversion Recurrence of AF	atrial fibrillation	Colchicine (NPC226941)	NP level
NCT03575572	Colchicine in Postoperative Fontan Patients	heart disease	Colchicine (NPC226941)	NP level
NCT04350320	Trial to Study the Benefit of Colchicine in Patients With COVID-19	COVID-19	Colchicine (NPC226941)	NP level
NCT04360980	The Effects of Standard Protocol With or Without Colchicine in Covid-19 Infection	COVID-19	Colchicine (NPC226941)	NP level
NCT03131583	The Drug-Drug Interaction of SHR4640, Febuxostat and Colchicine in Patients With Gout	gout	Colchicine (NPC226941)	NP level
NCT00840489	Efficacy of Long-term Ribavirin in Non-responders With Chronic Hepatitis C and Advanced Fibrosis	chronic hepatitis C virus infection	Colchicine (NPC226941)	NP level
NCT00819585	A Study of the Efficacy of Canakinumab in Prevention of Acute Flares in Chronic Gout Patients Initiating Allopurinol Therapy (Core Study) and a Long-term Study of the Efficacy and Safety of Canakinumab in Patients With Gout (Extension Study)	gout	Colchicine (NPC226941)	NP level
NCT04724629	Survival TRial Using CytoKines in COVID-19 (STRUCK Trial)	COVID-19	Colchicine (NPC226941)	NP level
NCT04359095	Effectiveness and Safety of Medical Treatment for SARS-CoV-2 (COVID-19) in Colombia	COVID-19	Colchicine (NPC226941)	NP level
NCT04367168	Colchicine in Patients With Mild and Severe Coronavirus Disease	COVID-19	Colchicine (NPC226941)	NP level
NCT02442921	Colchicine for Diabetic Nephropathy Trial	diabetic nephropathy	Colchicine (NPC226941)	NP level
NCT04870424	Colchicine for Patients With Aortic Stenosis Undergoing Transcatheter Aortic Valve Replacement	atrial fibrillation	Colchicine (NPC226941)	NP level
NCT04603690	Oral Curcumin, Quercetin and Vitamin D3 Supplements for Mild to Moderate Symptoms of COVID-19	COVID-19	Colchicine (NPC226941)	NP level
NCT04328480	The ECLA PHRI COLCOVID Trial. Effects of Colchicine on Moderate/High-risk Hospitalized COVID-19 Patients.	COVID-19	Colchicine (NPC226941)	NP level
NCT04326790	The GReek Study in the Effects of Colchicine in Covid-19 cOmplications Prevention	COVID-19	Colchicine (NPC226941)	NP level
NCT00370760	Oral Colchicine Combined With Intravitreal Infusion of Dexamethasone, LMW Heparin and 5-FU for Management of Proliferative Vitreoretinopathy (PVR)	proliferative vitreoretinopathy	Colchicine (NPC226941)	NP level
NCT04500665	Anti-Inflammatory Treatment of Uremic Cardiomyopathy With Colchicine	chronic kidney disease	Colchicine (NPC226941)	NP level
NCT05324423	To Evaluate Drug Interactions Between XNW3009, Febuxostat, and Colchicine in Patients With Gout	gout	Colchicine (NPC226941)	NP level
NCT01075906	Pharmacokinetics Study of Colchicine in Familial Mediterranean Fever (FMF) Patients	familial Mediterranean fever	Colchicine (NPC226941)	NP level
NCT04705987	Randomized Double-blind Trial to Study the Benefit of Colchicine in Patients With Acutely Decompensated Heart Failure	heart failure	Colchicine (NPC226941)	NP level
NCT05279690	Pilot Trial of Colchicine in Urothelial Cancer and Other Solid Tumors	neoplasm;urogenital neoplasm	Colchicine (NPC226941)	NP level
NCT05151614	Adjuvant Use Of Colchicine With The Standard Therapy In Moderate And Severe Corona Virus Disease-19 Infection	COVID-19	Colchicine (NPC226941)	NP level
NCT02602028	The Comparison of the Efficacy of Once and Twice Daily Colchicine Dosage in Pediatric Patients With FMF	familial Mediterranean fever	Colchicine (NPC226941)	NP level
NCT02366091	Inflammation and Coronary Endothelial Function	coronary artery disease	Colchicine (NPC226941)	NP level
NCT04130204	Topical Application to Relieve Gout: Efficacy Trial & Safety (TARGETS)	gout	Colchicine (NPC226941)	NP level
NCT05459974	Use of Colchicine to Decrease Atrial Fibrillation Recurrence After Ablation	atrial fibrillation	Colchicine (NPC226941)	NP level
NCT04416334	PREEMPTIVE THERAPY WITH COLCHICINE IN PATIENTS OLDER THAN 60 YEARS WITH HIGH RISK OF SEVERE PNEUMONIAE DUE TO CORONAVIRUS	COVID-19	Colchicine (NPC226941)	NP level
NCT01985425	Colchicine For Prevention of Perioperative Atrial Fibrillation in Patients Undergoing Thoracic Surgery Pilot Study	atrial fibrillation	Colchicine (NPC226941)	NP level
NCT00700297	Colchicine Randomized Double-Blind Controlled Crossover Study in Behcet's Disease	Behcet's syndrome	Colchicine (NPC226941)	NP level
NCT04375202	Colchicine in COVID-19: a Pilot Study	COVID-19	Colchicine (NPC226941)	NP level
NCT04160117	Impact of Short-course Colchicine Versus Placebo After Pulmonary Vein Isolation (IMPROVE-PVI Pilot)	atrial fibrillation	Colchicine (NPC226941)	NP level
NCT05118737	Adding Colchicine to Tocilizumab in Patients With Severe COVID-19 Pneumonia.	COVID-19	Colchicine (NPC226941)	NP level
NCT04916522	The COlchicine HypERtENsion Trial	hypertension	Colchicine (NPC226941)	NP level
NCT02500641	Intensive Urate Lowering Therapy of Febuxostat Compared to Allopurinol on Cardiovascular Risk in Patients With Gout	gout	Colchicine (NPC226941)	NP level
NCT02060552	Immune Molecular and Inflammatory Cytokines Dysfunction Analysis in Gout Patients With Different Urate Levels	gout	Colchicine (NPC226941)	NP level
NCT03693781	Colchicine for Amyotrophic Lateral Sclerosis	amyotrophic lateral sclerosis	Colchicine (NPC226941)	NP level
NCT00506883	MPC-004 for the Treatment of an Acute Gout Flare	gout	Colchicine (NPC226941)	NP level
NCT04667780	Study to Investigate the Treatment Effect of Colchicine in Patients With COVID-19	COVID-19	Colchicine (NPC226941)	NP level
NCT00723268	Evaluation of Therapeutic Effect of 0.5 mg Colchicine and 5 mg Prednisolone on Oral Aphthae	aphthous ulcer	Colchicine (NPC226941)	NP level
NCT05250596	COLchicine On-admission to Reduce Inflammation in Acute Coronary Syndrome (COLOR-ACS)	acute coronary syndrome	Colchicine (NPC226941)	NP level
NCT03905759	Prophylaxis Against Postoperative Atrial Fibrillation in Patients Undergoing On-pump CABG	atrial fibrillation	Colchicine (NPC226941)	NP level
NCT04420624	COLchicine to Prevent Sympathetic Denervation After an Acute Myocardial Infarction	myocardial infarction	Colchicine (NPC226941)	NP level
NCT00754819	Targeting Inflammation in Acute Coronary Syndrome Using Colchicine	acute coronary syndrome	Colchicine (NPC226941)	NP level
NCT00004368	Phase I Study of Colchicine Therapy in Childhood Hepatic Cirrhosis	cirrhosis of liver	Colchicine (NPC226941)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	NCT02582190,NCT01985425,NCT03905759,NCT04160117,NCT03015831,NCT04870424,NCT01755949,NCT05459974
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	THPO,PAX8,TUBB6,GMNN,SLC22A3,LMNA
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	PAX8,TUBB6,SLC22A3,KIT,LMNA
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	PAX8,TUBB6,GMNN,LMNA
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	PAX8,GMNN,SLC22A3,LMNA
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CYP1A1,CYP3A4,CYP1A2,KIT
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	THPO NCT03156816,NCT04420624
Severe acute respiratory syndrome Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D65	NCT04516941,NCT04324463,NCT04381936
Acute ischaemic heart disease, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA4Z	NCT00754819,NCT05472337,NCT05250596
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	GMNN,PAX8,GMNN
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CYP3A4,CYP1A2,PAX8
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	THPO,CYP2D6,GMNN
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CYP1A1,PAX8,CYP2D6
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	TUBB6,GMNN,LMNA
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	GMNN,CYP3A4,KIT
COVID-19 Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D6Y	NCT04472611,NCT04375202,NCT04392141,NCT04324463,NCT04363437,NCT04492358,NCT05151614,NCT04724629,NCT04997551,NCT04762771,NCT05118737,NCT04360980,NCT04359095,NCT04667780,NCT04355143,NCT04328480,NCT04867226,NCT04326790,NCT04416334,NCT04367168,NCT04350320,NCT04539873,NCT04603690,NCT04756128,NCT04516941,NCT04322682
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	KIT,CYP3A4
coronary artery disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA8Y-BA8Z	NCT05175274,NCT02366091
Familial Mediterranean fever Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A60.0	NCT01075906,NCT02602028
Chronic kidney disease, stage unspecified Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61.Z	NCT01005121,NCT02442921
Acute pericarditis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB20	NCT00128414,NCT00128453
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	GMNN,PAX8
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	GMNN,CYP1A2
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	KIT,GMNN
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CYP1A1,SLC22A3
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA,TUBB6
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CYP1A1,THPO
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CYP3A4,GMNN
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	GMNN,KIT
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	THPO,TUBB6
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	NCT00506883,NCT02500641,NCT02139046,NCT01399008,NCT03131583,NCT04130204,NCT02330796,NCT05324423,NCT02060552,NCT01994226,NCT00819585,NCT02063997
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	KIT
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	KIT
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	KIT
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	KIT
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	KIT
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CYP2D6
Phakomatoses/hamartoneoplastic syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2D	KIT
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	KIT
Inflammatory arthropathy Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA2Z	KIT
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	KIT
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	CYP3A4
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	THPO
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	KIT
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	KIT
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	KIT
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	KIT
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	KIT
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	KIT
Malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F40-1F45	CYP2D6
Malignant intestine neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C0Z	KIT
Bone/articular cartilage neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F7B	KIT
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	KIT
Mastocytosis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A21	KIT
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	CYP3A4
Cholangiocarcinoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH7M15	NCT04264260
Vitreoretinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B78	NCT00370760
NA Disease Category: NA Disease ICD-11 Code: NA	NCT00000577
Hepatic fibrosis/cirrhosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB93	NCT00004368
Amyotrophic lateral sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B60.0	NCT03693781
Diseases of the circulatory system, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BE2Z	NCT02162303
Oral aphthae or aphtha-like ulceration Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA01.10	NCT00723268
Vasculitis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A44	NCT04008316
Urogenital cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C95-2C9Z	NCT05279690
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	NCT00000577
Primary biliary cholangitis, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB96.1Z	NCT00004748
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	NCT04916522
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	NCT04500665
Cardiac arrhythmia Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC9Z	NCT03021343
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	NCT04322565
Acute non-ST elevation myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41.1	NCT03048825
Acute ST elevation myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41.0	NCT03048825
Behçet disease Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A62	NCT00700297
Intracranial injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NA07	NCT05159219
Coronary atherosclerosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA80	NCT05503225
Osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA00-FA05	NCT02176460
Viral pneumonia Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.1	NCT04322565
Ischemic heart disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40-BA6Z	NCT03575572
Chronic hepatitis C Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E51.1	NCT00840489
Postcardiotomy syndrome Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BE10	NCT00128427
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	NCT01481233
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	NCT04705987
Neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 02	NCT05279690
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CYP1A1
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	KIT
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CYP1A1
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	GMNN
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	KIT
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CYP1A1
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	CYP1A1
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	KIT
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	THPO

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Isodon Megathyrsus

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

9 All known Ingredients in Total

7 Ingredients with Acceptable Bioavailablity

5 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Atrial fibrillation

Diffuse large B-cell lymphomas

Adenocarcinoma of pancreas

Malignant neoplasms of biliary tract, distal bile duct

Mesothelioma of pleura

Renal cell carcinoma, chromophobe type

Myocardial infarction

Severe acute respiratory syndrome

Acute ischaemic heart disease, unspecified

Hepatocellular carcinoma of liver

Urothelial carcinoma of bladder

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Glioblastoma of brain

Malignant neoplasms of adrenal gland

COVID-19

Solid tumour/cancer

coronary artery disease

Familial Mediterranean fever

Chronic kidney disease, stage unspecified

Acute pericarditis

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Hepatoblastoma

Other specified malignant neoplasms ofcolon

Superficial ovarian endometriosis

Cytomegaloviral disease

Malignant neoplasms of thymus

Germ cell tumour of testis

Carpal tunnel syndrome

Gout

Liver cancer

Gastrointestinal stromal tumour

Acute myeloid leukaemia

Myeloproliferative neoplasm

Colorectal cancer

Insomnia

Phakomatoses/hamartoneoplastic syndrome

Brain cancer

Inflammatory arthropathy

Mature B-cell lymphoma

Atopic eczema

Ischaemic/haemorrhagic stroke

Renal cell carcinoma

Thrombocytopenia

Postoperative inflammation

Alzheimer disease

Myelodysplastic syndrome

Multiple myeloma

Malaria

Malignant intestine neoplasm

Bone/articular cartilage neoplasm

Lung cancer

Mastocytosis

Anxiety

Cholangiocarcinoma

Vitreoretinopathy

NA

Hepatic fibrosis/cirrhosis

Amyotrophic lateral sclerosis

Diseases of the circulatory system, unspecified

Oral aphthae or aphtha-like ulceration

Vasculitis

Urogenital cancer