CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Lycopus Lucidus

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAGACCTGCAGAGCAGACCGCGAACACGTGCCTAACTCGGCGGGGCACGGCGACGGGGCCCAGGCCCCCCGCCGCGCCACCGCTCCCCGCCGGCGTGCGCCCTCGGGTCGCGCCGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACGCAACGAAGCGTCCGCCCCCCCGCGCGCCGTCCGCGGAGTGCGACGGGGGGGTCGGCCGTCTATCTATAGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCTCCCAGCGCACCGCGCGGGCGGGCGGGGGCGGATATTGGCCCCCCGTGCGCCCCGGCGCGCGGTCGGCCCAAATGCGATCCCTCGGCGACTCGTGTCACGACAAGTGGTGGTTGAGCGACTCAATCTAGCGCGCCGTCGTGCTCCCGCGTCGTCCGCACGGGCATCCGCGAACGACCCAACGGTGTCGGCGCCCCGGGGCGCCCCACCTCCGA

Click for details-----ITS1

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO21824
Plant Latin Name: Lycopus Lucidus
Taxonomy Genus: Lycopus
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 516551
Plant-of-the-World-Online: 449660-1

Used in Medicines

Country/Region:

China

Traditional Medicine System:

TCM

Medicinal Functions:

Cardiotonic; Diuretic; Hepatic

Geographical Distribution

Italy; South Africa; China; Japan; Taiwan; Russia

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

70 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

41 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)