• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Berberis Crataegina


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

GCCAGGGCGGCAGCTCATTGTTAAACCTGCATAGCAGAAAGACCCGCGAACTTGTGAGCAACTATATTGGGAGAGGGATACGGGTCTCTTGGACTCCTTCCCTCGATTTCGGACCGAGGAGTGCCCTTGTCGGCATTCTTTGGCTCTGATAAAATAACAAACTCGGCGCGATCAGCGCCAAGGAAAATTAAATGGAAATAGCTTGCCCTTGCTCTTGCAAGATGGTATTGCTTATCTGATATTCGAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO21822
Plant Latin Name: Berberis Crataegina
Taxonomy Genus: Berberis
Taxonomy Family: Berberidaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

57 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


46 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

19 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98939

Ingredient ID: NPC98743

Ingredient ID: NPC96428

Ingredient ID: NPC96294

Ingredient ID: NPC95247

Ingredient ID: NPC90305

Ingredient ID: NPC88090

Ingredient ID: NPC85715

Ingredient ID: NPC83497

Ingredient ID: NPC76336

Ingredient ID: NPC75613

Ingredient ID: NPC5383

Ingredient ID: NPC49579

Ingredient ID: NPC43300

Ingredient ID: NPC41346

Ingredient ID: NPC37661

Ingredient ID: NPC34700

Ingredient ID: NPC311566

Ingredient ID: NPC292893

Ingredient ID: NPC29280

Ingredient ID: NPC290598

Ingredient ID: NPC286388

Ingredient ID: NPC283389

Ingredient ID: NPC28239

Ingredient ID: NPC278948

Ingredient ID: NPC270797

Ingredient ID: NPC268356

Ingredient ID: NPC266483

Ingredient ID: NPC262093

Ingredient ID: NPC261566

Ingredient ID: NPC244315

Ingredient ID: NPC243728

Ingredient ID: NPC239881

Ingredient ID: NPC238100

Ingredient ID: NPC237255

Ingredient ID: NPC235839

Ingredient ID: NPC220210

Ingredient ID: NPC219876

Ingredient ID: NPC219090

Ingredient ID: NPC219040

Ingredient ID: NPC216230

Ingredient ID: NPC206264

Ingredient ID: NPC187508

Ingredient ID: NPC182321

Ingredient ID: NPC181465

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC166409

Ingredient ID: NPC156654

Ingredient ID: NPC154599

Ingredient ID: NPC153502

Ingredient ID: NPC143326

Ingredient ID: NPC142754

Ingredient ID: NPC138374

Ingredient ID: NPC137949

Ingredient ID: NPC134909

Ingredient ID: NPC121270