• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Gentianopsis Paludosa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCGAAGCAGACGACCCGAGAACTTGTATATCGCACGGGCGTCCGGGACGCGGGAAACCACGGACCGGCGCCCCGAGCACGGCGTCGACCATCGGTCGCCCGTCGTGCACATAAACAACCCCGGGCGCATAAAAGCGCCAAGGAAAACAAGAAAGGGATTGCCTGCCTCTCGATGCGCCGTACGCGGAGTGCACGGGAGGGAAAAAGGCGCCTGAATAAACATAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAACTGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCAACCTCGTGCGTTGACTCGTACGGGTGACATGAGGGGGCGGATGATGGCTTCCCGTGTCTAGTCGCGGCTGGCCTAAATGTGAGTCCCTTGCGACGGACGTGACGACAAGTGGTGGTTGATTACCTCAACTAAGGTGCTGTTGTTCTACGGCCGTCGAATTAGAAGACTCTCCGACCCTAATGCACGCGTCATAACGCTTGCTACGACCGCGACCCCAGGTCAGGCGGGAT

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCCCCCCAACCTCGTGCGTTGACTCGTACGGGTGACATGAGGGGGCGGATGATGGCTTCCCGTGTCTAGTCGCGGCTGGCCTAAATGTGAGTCCCTTGCGACGGACGTGACGACAAGTGGTGGTTGATTACCTCAACTAAGGTGCTGTTGTTCTACGGCCGTCGAATTAGAAGACTCTCCGACCCTAATGCACGCGTCATAACGCTTGCTACGACCGCGACCCCAGGTCAGGCGGGAT
Taxonomic Information

Plant ID: NPO21803
Plant Latin Name: Gentianopsis Paludosa
Taxonomy Genus: Gentianopsis
Taxonomy Family: Gentianaceae

Plant External Links:

NCBI TaxonomyDB: 50802
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

11 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


8 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

5 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC44821

Ingredient ID: NPC37859

Ingredient ID: NPC279121

Ingredient ID: NPC264711

Ingredient ID: NPC244708

Ingredient ID: NPC208198

Ingredient ID: NPC195019

Ingredient ID: NPC180234

Ingredient ID: NPC126024

Ingredient ID: NPC121970

Ingredient ID: NPC117579