• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Crinum Giganteum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTAGGTGACCTGCGGAGGATCATTGTCGAGAACCGACCGAAAGACCGCGAACCTGTAAACGGATGACGCCGTGTCGGGCGGGCATCATGCCCGCCCTGCTCGGGACCTCGCACCGTGTCCGCGGCCGCCCTGGGCGTTACGGACACGATTTGCGGGGGACGGACGAAACCCCGGCGCGGCCTGCGCCAAGGAACATATGACAGGACGGACGCGCGTCAACGCCTCCGTGGTGGGGCGACGTCCGCTCTTTATCTGTACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACCTTGTTTCGCTCTACGGCCATGCCCCTTTGGGAGCGGTCATGGATGCGGAGAGTGGCCCTCCGTGCCTCGTGTGCGGCGGGCTTAAGTGTGGGCTGTCGGCGCCGGGATGGGCACGATGAGTGGTGGACGGAGCACCAGCAGGATGTCGTGGCCCCCCCGTTGCCTTGAGGGGCTCAAGAGACCCGGACTAGGCGAGCCGTCCTCCGTACGAGGAGGGCGTGCCGTCTCGCAATGCGACCCCAG

Click for details-----ITS1

GTAGGTGACCTGCGGAGGATCATTGTCGAGAACCGACCGAAAGACCGCGAACCTGTAAACGGATGACGCCGTGTCGGGCGGGCATCATGCCCGCCCTGCTCGGGACCTCGCACCGTGTCCGCGGCCGCCCTGGGCGTTACGGACACGATTTGCGGGGGACGGACGAAACCCCGGCGCGGCCTGCGCCAAGGAACATATGACAGGACGGACGCGCGTCAACGCCTCCGTGGTGGGGCGACGTCCGCTCTTTATCTGTA

Click for details-----ITS2

CTTGTTTCGCTCTACGGCCATGCCCCTTTGGGAGCGGTCATGGATGCGGAGAGTGGCCCTCCGTGCCTCGTGTGCGGCGGGCTTAAGTGTGGGCTGTCGGCGCCGGGATGGGCACGATGAGTGGTGGACGGAGCACCAGCAGGATGTCGTGGCCCCCCCGTTGCCTTGAGGGGCTCAAGAGACCCGGACTAGGCGAGCCGTCCTCCGTACGAGGAGGGCGTGCCGTCTCGCAATGCGACCCCAG
Taxonomic Information

Plant ID: NPO21547
Plant Latin Name: Crinum Giganteum
Taxonomy Genus: Crinum
Taxonomy Family: Amaryllidaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

67 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


55 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

22 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC95676

Ingredient ID: NPC94304

Ingredient ID: NPC94218

Ingredient ID: NPC94045

Ingredient ID: NPC93033

Ingredient ID: NPC90787

Ingredient ID: NPC85813

Ingredient ID: NPC85327

Ingredient ID: NPC82648

Ingredient ID: NPC82363

Ingredient ID: NPC79527

Ingredient ID: NPC78540

Ingredient ID: NPC76145

Ingredient ID: NPC62086

Ingredient ID: NPC5708

Ingredient ID: NPC4827

Ingredient ID: NPC4125

Ingredient ID: NPC3922

Ingredient ID: NPC3649

Ingredient ID: NPC3190

Ingredient ID: NPC312391

Ingredient ID: NPC306616

Ingredient ID: NPC299529

Ingredient ID: NPC281994

Ingredient ID: NPC270074

Ingredient ID: NPC269806

Ingredient ID: NPC268862

Ingredient ID: NPC266021

Ingredient ID: NPC26583

Ingredient ID: NPC265513

Ingredient ID: NPC261831

Ingredient ID: NPC258723

Ingredient ID: NPC257522

Ingredient ID: NPC249018

Ingredient ID: NPC243601

Ingredient ID: NPC229403

Ingredient ID: NPC225406

Ingredient ID: NPC225284

Ingredient ID: NPC223417

Ingredient ID: NPC219573

Ingredient ID: NPC215702

Ingredient ID: NPC213322

Ingredient ID: NPC20892

Ingredient ID: NPC207869

Ingredient ID: NPC206380

Ingredient ID: NPC202691

Ingredient ID: NPC197378

Ingredient ID: NPC194383

Ingredient ID: NPC181582

Ingredient ID: NPC180612

Ingredient ID: NPC178859

Ingredient ID: NPC17458

Ingredient ID: NPC170070

Ingredient ID: NPC166894

Ingredient ID: NPC163424

Ingredient ID: NPC157923

Ingredient ID: NPC15292

Ingredient ID: NPC149570

Ingredient ID: NPC149203

Ingredient ID: NPC148677

Ingredient ID: NPC142871

Ingredient ID: NPC127447

Ingredient ID: NPC125962

Ingredient ID: NPC121270

Ingredient ID: NPC114239

Ingredient ID: NPC105380

Ingredient ID: NPC100178

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1A2 Cytochrome P450 1A2 P05177 CHEMBL3356
Cytochrome P450 Cytochrome P450 family 1 CYP1A1 Cytochrome P450 1A1 P04798 CHEMBL2231
Cytochrome P450 Cytochrome P450 family 1 CYP1B1 Cytochrome P450 1B1 Q16678 CHEMBL4878
Cytochrome P450 Cytochrome P450 family 19 CYP19A1 Cytochrome P450 19A1 P11511 CHEMBL1978
Cytochrome P450 Cytochrome P450 family 2 CYP2C19 Cytochrome P450 2C19 P33261 CHEMBL3622
Therapeutic Target Enzyme AKR1C3 Aldo-keto-reductase family 1 member C3 P42330 CHEMBL4681
Therapeutic Target Fatty acid binding protein family FABP5 Fatty acid binding protein epidermal Q01469 CHEMBL3674
Therapeutic Target Lyase CA7 Carbonic anhydrase VII P43166 CHEMBL2326
Therapeutic Target Lyase CA4 Carbonic anhydrase IV P22748 CHEMBL3729
Therapeutic Target Nuclear hormone receptor subfamily 1 PPARA Peroxisome proliferator-activated receptor alpha Q07869 CHEMBL239
Therapeutic Target Oxidoreductase CBR1 Carbonyl reductase [NADPH] 1 P16152 CHEMBL5586
Therapeutic Target Oxidoreductase XDH Xanthine dehydrogenase P47989 CHEMBL1929
Therapeutic Target Oxidoreductase ALOX15 Arachidonate 15-lipoxygenase P16050 CHEMBL2903
Therapeutic Target Small molecule receptor (family A GPCR) FFAR1 Free fatty acid receptor 1 O14842 CHEMBL4422
Therapeutic Target Small molecule receptor (family A GPCR) FFAR4 G-protein coupled receptor 120 Q5NUL3 CHEMBL5339
Therapeutic Target Structural protein LMNA Prelamin-A/C P02545 CHEMBL1293235
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level11
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT00029679 Borage Oil and Ginkgo Biloba (EGb 761) in Asthma asthma Linoleic Acid (NPC85813) NP level
NCT01661764 Fish Oil Supplementation, Nutrigenomics and Colorectal Cancer Prevention colorectal adenoma Oleic Acid (NPC261831) NP level
NCT00951158 A Molecular Pharmacodynamic Dose-titration Trial of Conjugated Linoleic Acid (CLA; Clarinol®) in Patients With Advanced Solid Tumors neoplasm Linoleic Acid (NPC85813) NP level
NCT00908791 Proof of Principle Trial to Determine if Nutritional Supplement Conjugated Linoleic Acid (CLA) Can Modulate the Lipogenic Pathway in Breast Cancer Tissue breast cancer Linoleic Acid (NPC85813) NP level
NCT00607945 Dietary Fatty Acids as Complementary Therapy in Type 2 Diabetes Mellitus type 2 diabetes mellitus Linoleic Acid (NPC85813) NP level
NCT04392622 d-Limonene +Radiation +Platinum Based Chemo for Xerostomia Prevention in Locally Advanced Head and Neck Squamous Cell Carcinoma xerostomia Limonene (NPC76145) NP level
NCT02063802 Metformin vs Conjugated Linoleic Acid and an Intervention Program With Healthy Habits in Obese Children obesity Linoleic Acid (NPC85813) NP level
NCT00638196 Placebo vs. Linoleic Acid Controlled Assessment of Treatment Efficacy in MS multiple sclerosis Oleic Acid (NPC261831) NP level
NCT01792310 A Phase 1/2A Study of LAM561 in Adult Patients With Advanced Solid Tumours glioma Oleic Acid (NPC261831) NP level
NCT00204932 Effects of CLA Supplements on Body Weight and Fat Oxidation obesity Linoleic Acid (NPC85813) NP level
NCT04853082 Limonene on Regulating Metabolism-related Fatty Liver Disease (MAFLD) and Analysis of TCM Constitution Hepatic steatosis Limonene (NPC76145) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 FFAR1,CA7,FFAR4,FABP5,CYP19A1,ALOX15,XDH
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 FFAR1,FABP3,PPARA,FABP4,FABP5,LMNA,CBR1
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 FFAR1,CA7,FFAR4,LMNA,ALOX15,XDH,CBR1
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 CA4,FABP4,FABP5,CYP19A1,AKR1C3,AKR1C3,CYP19A1
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 FFAR1,FABP3,CA4,CA7,FABP5,CYP19A1,CBR1
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 FABP3,CYP1A2,FFAR4,FABP5,ALOX15,XDH
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 FFAR4,FABP5,CYP19A1,XDH,FABP5,FFAR4
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 FABP3,CA4,FABP4,FABP5,CYP19A1
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 CA7,XDH,AKR1C3,CBR1
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CA7,FFAR1,XDH,CYP1B1
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 CA7,XDH,AKR1C3,CBR1
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 FFAR1,CYP19A1,XDH,LMNA
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 CYP1B1,FFAR4,FABP5,ALOX15
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CYP1B1,FABP5,CYP19A1,LMNA
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 FABP3,CA4,FABP5,XDH
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 CA4,CBR1
 NCT00029679
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 PPARA,CA4,XDH
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 CA4,CYP19A1
 NCT00908791
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 PPARA,FFAR1
 NCT00607945
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 CA4,FABP5,XDH
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 CA4,FABP5,LMNA
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 FABP3,LMNA,CA4
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 CYP1A1,ALOX15,CYP2C19
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 CYP1A1,ALOX15,XDH
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 FFAR1,PPARA
Gout
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA25
 PPARA,XDH
Non-alcoholic fatty liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB92
 PPARA
 FABP4
Obesity
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B80-5B81
 NCT00204932,NCT02063802
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 CYP19A1,ALOX15
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 FABP4,AKR1C3
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 CYP19A1,CBR1
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 FFAR1,FABP3
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 XDH,AKR1C3
Adenocarcinoma of prostate
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82.0
 FABP5,ALOX15
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 FFAR1,CYP1A1
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CYP1A2,CYP1A1
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 CYP1B1,FFAR4
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 FABP3,CA7,CYP1B1,FFAR4,LMNA,ALOX15,XDH,AKR1C3,CBR1,CYP2C19
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 AKR1C3
Female pelvic pain
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA34
 AKR1C3
Hyperlipidemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80
 PPARA
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 CA4
Influenza
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E30-1E32
 XDH
Oesophagitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA24
 CYP19A1
Cushing syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A70
 CYP19A1
Diabetes mellitus, type unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A14
 PPARA
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 PPARA
Neuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C0Z
 CYP19A1
Encephalopathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E47
 XDH
Hyper-lipoproteinaemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80
 PPARA
Inborn purine/pyrimidine/nucleotide metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C55
 XDH
Chronic kidney disease
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB61
 XDH
Dyslipidemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80-5C81
 PPARA
Endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10
 CYP19A1
Idiopathic interstitial pneumonitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB03
 FFAR1
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA4
Mineral deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B5K
 XDH
Inborn lipid metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C52
 PPARA
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA4
Heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10-BD1Z
 XDH
Xerostomia
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA02.1
 NCT04392622
Colorectal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B91
 NCT01661764
Glioma, malignant
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH4RQ3
 NCT01792310
Other specified non-alcoholic fatty liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB92.Y
 NCT04853082
Multiple sclerosis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A40
 NCT00638196
Neoplasms
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 02
 NCT00951158
Coeliac disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA95
 CYP1A1
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 FABP5
Atrial fibrillation
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC81.3
 CA7
Myotonic dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71.0
 CYP1A1
Malignant neoplasms of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94
 FABP4
Keratoconus
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9A78.50
 CA4
Pre-eclampsia
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA24
 CA4
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 CA4
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 CYP1A1
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 ALOX15
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 CYP1A2
Systemic sclerosis
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A42
 FABP4
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 CYP1A1
Malignant neoplasms of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 FABP4
Polycystic ovary syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80.1
 FFAR4
Heart failure, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD1Z
 CYP1B1
Human immunodeficiency virus disease without mention of tuberculosis or malaria
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C62
 FFAR1
Malignant neoplasm of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 FABP4
Gliomas of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.0
 AKR1C3

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group