• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Anethum Graveolens


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCGATAGCAGAATGACCCGCTAACACGTAAACACATTGGGCAAGCTTCAGAGGGCTTCGGTCCCCTGTTTGCAAACCCTTGGTAGGTGTCCCCCTCTATGGTGGTCACCGGCCTACGAAATCATCCGGGCGCGGAATGCGCCAAGGAACTTAAAATTGAATTGTACGTTCGCATCCCGTTAGCGGGCATCGAACGTCATTCCAAAACACAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCAATAGGCCGAGGGCACGTCTGCCTGGGTGTCACACATTTGCTTGCCCCAACCACTCACTCCTTGATGAGATGTGCTGGTTTTTGGGCGGAAATTGGCCTCCCGTGCTGTATTGTGCGGTTGGTGCAAAAGCGAGTGTCGGGCGTTGGACGTCGTGACATTCGGTGGTTGTAAAAGACCCTCTTGACTTGTCGCACGAATCCTCGTCATCTAACTGAGCTCTAGGGGCCTTGGTCGCTACACAATCTGTCGCCCTAACTGGACCCCGTTGTGCGGTCGTTGTGTCGTCTGCGGTCC

Click for details-----ITS1

NA

Click for details-----ITS2

ATTTGCTTGCCCCAACCACTCACTCCTTGATGAGATGTGCTGGTTTTTGGGCGGAAATTGGCCTCCCGTGCTGTATTGTGCGGTTGGTGCAAAAGCGAGTGTCGGGCGTTGGACGTCGTGACATTCGGTGGTTGTAAAAGACCCTCTTGACTTGTCGCACGAATCCTCGTCATCTAACTGAGCTCTAGGGGCCTTGGTCGCTACACAATCTGTCGCCCTAACTGGACCCCGTTGTGCGGTCGTTGTGTCGTCTGCGGTCC
Taxonomic Information

Plant ID: NPO21460
Plant Latin Name: Anethum Graveolens
Taxonomy Genus: Anethum
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 40922
Plant-of-the-World-Online: 837530-1

Used in Medicines

Country/Region:
Italy; Finland; India; Jordan; China; Iraq; Russia; Bulgaria

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM


Medicinal Functions:

Antihalitosis; Aromatic; Carminative; Diuretic; Galactogogue; Stimulant; Stomachic

Geographical Distribution

Brazil; Turkey; Italy; Bangladesh; Sudan; France; Bahamas; Ethiopia; Somalia; Peru; Nigeria; Cameroon; Ghana; Belarus; Algeria; Cuba; Cape Verde; Russia; China; Belgium; Jordan; Dominican Republic; Iraq; Spain; Ukraine; Eritrea; Netherlands; Libya; Tanzania; Finland; United States; Morocco; Kenya; Switzerland; Haiti; Bulgaria; Jamaica; Romania; Albania; Angola; Portugal; Chad; Trinidad and Tobago; Tunisia; India; Austria; Mozambique; Greece; Hungary; Niger

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

182 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


158 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

110 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC94366

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC92943

Ingredient ID: NPC92869

Ingredient ID: NPC90566

Ingredient ID: NPC90486

Ingredient ID: NPC88566

Ingredient ID: NPC85813

Ingredient ID: NPC85210

Ingredient ID: NPC81010

Ingredient ID: NPC78312

Ingredient ID: NPC76145

Ingredient ID: NPC74539

Ingredient ID: NPC73980

Ingredient ID: NPC72042

Ingredient ID: NPC71339

Ingredient ID: NPC70691

Ingredient ID: NPC68391

Ingredient ID: NPC65134

Ingredient ID: NPC62765

Ingredient ID: NPC62045

Ingredient ID: NPC60151

Ingredient ID: NPC58970

Ingredient ID: NPC55412

Ingredient ID: NPC53559

Ingredient ID: NPC502

Ingredient ID: NPC491218

Ingredient ID: NPC49074

Ingredient ID: NPC490332

Ingredient ID: NPC489907

Ingredient ID: NPC46254

Ingredient ID: NPC45727

Ingredient ID: NPC43246

Ingredient ID: NPC424

Ingredient ID: NPC40277

Ingredient ID: NPC38742

Ingredient ID: NPC38212

Ingredient ID: NPC34764

Ingredient ID: NPC33415

Ingredient ID: NPC32991

Ingredient ID: NPC329460

Ingredient ID: NPC328447

Ingredient ID: NPC323463

Ingredient ID: NPC322254

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC31279

Ingredient ID: NPC312132

Ingredient ID: NPC311783

Ingredient ID: NPC311255

Ingredient ID: NPC309330

Ingredient ID: NPC302857

Ingredient ID: NPC301586

Ingredient ID: NPC300326

Ingredient ID: NPC300059

Ingredient ID: NPC298505

Ingredient ID: NPC296071

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293628

Ingredient ID: NPC291473

Ingredient ID: NPC290843

Ingredient ID: NPC290319

Ingredient ID: NPC28913

Ingredient ID: NPC28828

Ingredient ID: NPC284038

Ingredient ID: NPC283170

Ingredient ID: NPC281686

Ingredient ID: NPC279661

Ingredient ID: NPC279121

Ingredient ID: NPC278642

Ingredient ID: NPC27836

Ingredient ID: NPC272614

Ingredient ID: NPC269919

Ingredient ID: NPC269242

Ingredient ID: NPC267801

Ingredient ID: NPC265305

Ingredient ID: NPC264784

Ingredient ID: NPC264020

Ingredient ID: NPC263089

Ingredient ID: NPC262505

Ingredient ID: NPC261644

Ingredient ID: NPC260837

Ingredient ID: NPC259134

Ingredient ID: NPC258476

Ingredient ID: NPC257124

Ingredient ID: NPC255042

Ingredient ID: NPC252587

Ingredient ID: NPC251666

Ingredient ID: NPC247553

Ingredient ID: NPC244315

Ingredient ID: NPC242580

Ingredient ID: NPC241258

Ingredient ID: NPC239039

Ingredient ID: NPC237812

Ingredient ID: NPC235260

Ingredient ID: NPC235190

Ingredient ID: NPC232375

Ingredient ID: NPC232247

Ingredient ID: NPC232141

Ingredient ID: NPC231738

Ingredient ID: NPC229347

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225710

Ingredient ID: NPC225709

Ingredient ID: NPC220765

Ingredient ID: NPC219876

Ingredient ID: NPC219143

Ingredient ID: NPC216825

Ingredient ID: NPC215632

Ingredient ID: NPC214971

Ingredient ID: NPC213876

Ingredient ID: NPC213749

Ingredient ID: NPC210456

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC204388

Ingredient ID: NPC203468

Ingredient ID: NPC202992

Ingredient ID: NPC201844

Ingredient ID: NPC200838

Ingredient ID: NPC199072

Ingredient ID: NPC197087

Ingredient ID: NPC195355

Ingredient ID: NPC193989

Ingredient ID: NPC191103

Ingredient ID: NPC190810

Ingredient ID: NPC19003

Ingredient ID: NPC189436

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC182468

Ingredient ID: NPC179987

Ingredient ID: NPC17810

Ingredient ID: NPC177112

Ingredient ID: NPC176819

Ingredient ID: NPC175771

Ingredient ID: NPC174246

Ingredient ID: NPC172625

Ingredient ID: NPC169749

Ingredient ID: NPC168290

Ingredient ID: NPC167400

Ingredient ID: NPC165302

Ingredient ID: NPC163984

Ingredient ID: NPC161593

Ingredient ID: NPC157340

Ingredient ID: NPC152451

Ingredient ID: NPC152384

Ingredient ID: NPC150950

Ingredient ID: NPC147983

Ingredient ID: NPC146422

Ingredient ID: NPC145463

Ingredient ID: NPC144023

Ingredient ID: NPC13990

Ingredient ID: NPC138113

Ingredient ID: NPC137958

Ingredient ID: NPC137949

Ingredient ID: NPC135539

Ingredient ID: NPC13449

Ingredient ID: NPC133183

Ingredient ID: NPC13304

Ingredient ID: NPC13143

Ingredient ID: NPC126681

Ingredient ID: NPC125085

Ingredient ID: NPC125062

Ingredient ID: NPC119949

Ingredient ID: NPC118429

Ingredient ID: NPC117529

Ingredient ID: NPC117299

Ingredient ID: NPC116775

Ingredient ID: NPC115919

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC111888

Ingredient ID: NPC111690

Ingredient ID: NPC110899

Ingredient ID: NPC105246

Ingredient ID: NPC104190

Ingredient ID: NPC100773