• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Populus Angustifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTCGCCCCCTCTCCCCTCGGCTCACGAGGGCGGGGGCGGATACTGGTCTCCCGCGCGCTCCCGCTCGCGGCTGGCCCAAAATCGAGTCCTCGGCGACGGTCGCCACGACGAGCGGTGGTTGAGAGACCCTCGGACACTGTCGTGCGCGCGCCCGTCGCCCCCGGGATCTCCNGGACCCTCGGGCATCGACCTTCTAGGATGCCCTCG
Taxonomic Information

Plant ID: NPO21409
Plant Latin Name: Populus Angustifolia
Taxonomy Genus: Populus
Taxonomy Family: Salicaceae

Plant External Links:

NCBI TaxonomyDB: 351344
Plant-of-the-World-Online: n.a.

Used in Medicines

Unknown.

Geographical Distribution
Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

25 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


10 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

17 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC4586

Ingredient ID: NPC40702

Ingredient ID: NPC29883

Ingredient ID: NPC294815

Ingredient ID: NPC27641

Ingredient ID: NPC272471

Ingredient ID: NPC259488

Ingredient ID: NPC246162

Ingredient ID: NPC244776

Ingredient ID: NPC243728

Ingredient ID: NPC243702

Ingredient ID: NPC230301

Ingredient ID: NPC223426

Ingredient ID: NPC222602

Ingredient ID: NPC217520

Ingredient ID: NPC1786

Ingredient ID: NPC178134

Ingredient ID: NPC173977

Ingredient ID: NPC169749

Ingredient ID: NPC156654

Ingredient ID: NPC154779

Ingredient ID: NPC153755

Ingredient ID: NPC136702

Ingredient ID: NPC133671

Ingredient ID: NPC116775