CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Populus Angustifolia

Example Image

PLANiTS DNA barcode

ATCGTCGCCCCCTCTCCCCTCGGCTCACGAGGGCGGGGGCGGATACTGGTCTCCCGCGCGCTCCCGCTCGCGGCTGGCCCAAAATCGAGTCCTCGGCGACGGTCGCCACGACGAGCGGTGGTTGAGAGACCCTCGGACACTGTCGTGCGCGCGCCCGTCGCCCCCGGGATCTCCNGGACCCTCGGGCATCGACCTTCTAGGATGCCCTCG

Taxonomic Information

Plant ID: NPO21409
Plant Latin Name: Populus Angustifolia
Taxonomy Genus: Populus
Taxonomy Family: Salicaceae

Plant External Links:

NCBI TaxonomyDB: 351344
Plant-of-the-World-Online: n.a.

Used in Medicines

Unknown.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

25 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

10 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

17 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC4586

Ingredient ID: NPC40702

Ingredient ID: NPC29883

Ingredient ID: NPC294815

Ingredient ID: NPC27641

Ingredient ID: NPC272471

Ingredient ID: NPC259488

Ingredient ID: NPC246162

Ingredient ID: NPC244776

Ingredient ID: NPC243728

Ingredient ID: NPC243702

Ingredient ID: NPC230301

Ingredient ID: NPC223426

Ingredient ID: NPC222602

Ingredient ID: NPC217520

Ingredient ID: NPC1786

Ingredient ID: NPC178134

Ingredient ID: NPC173977

Ingredient ID: NPC169749

Ingredient ID: NPC156654

Ingredient ID: NPC154779

Ingredient ID: NPC153755

Ingredient ID: NPC136702

Ingredient ID: NPC133671

Ingredient ID: NPC116775

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Cysteine protease	CASP6	Caspase-6	P55212	CHEMBL3308
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Therapeutic Target	Enzyme	HPGD	15-hydroxyprostaglandin dehydrogenase [NAD+]	P15428	CHEMBL1293255
Therapeutic Target	Enzyme	RECQL	ATP-dependent DNA helicase Q1	P46063	CHEMBL1293236
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Enzyme	APEX1	DNA-(apurinic or apyrimidinic site) lyase	P27695	CHEMBL5619
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Isomerase	TOP2A	DNA topoisomerase II alpha	P11388	CHEMBL1806
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Lyase	GLO1	Glyoxalase I	Q04760	CHEMBL2424
Therapeutic Target	Lyase	CA14	Carbonic anhydrase XIV	Q9ULX7	CHEMBL3510
Therapeutic Target	Lyase	CA2	Carbonic anhydrase II	P00918	CHEMBL205
Therapeutic Target	Methyl-lysine/arginine binding protein	L3MBTL1	Lethal(3)malignant brain tumor-like protein 1	Q9Y468	CHEMBL1287622
Therapeutic Target	Other cytosolic protein	HSPA1A	Heat shock 70 kDa protein 1	P0DMV8	CHEMBL5460
Therapeutic Target	Oxidoreductase	AKR1B1	Aldose reductase	P15121	CHEMBL1900
Therapeutic Target	Oxidoreductase	HSD17B2	Estradiol 17-beta-dehydrogenase 2	P37059	CHEMBL2789
Therapeutic Target	Phosphodiesterase	TDP1	Tyrosyl-DNA phosphodiesterase 1	Q9NUW8	CHEMBL1075138
Therapeutic Target	Protein Kinase	INSR	Insulin receptor	P06213	CHEMBL1981
Therapeutic Target	Protein Kinase	PIM1	Serine/threonine-protein kinase PIM1	P11309	CHEMBL2147
Therapeutic Target	Protein Kinase	CSNK2A1	Casein kinase II alpha	P68400	CHEMBL3629
Therapeutic Target	Protein Kinase	IGF1R	Insulin-like growth factor I receptor	P08069	CHEMBL1957
Therapeutic Target	Protein Kinase	MET	Hepatocyte growth factor receptor	P08581	CHEMBL3717
Therapeutic Target	Protein Kinase	SRC	Tyrosine-protein kinase SRC	P12931	CHEMBL267
Therapeutic Target	Protein Kinase	TEK	Tyrosine-protein kinase TIE-2	Q02763	CHEMBL4128
Therapeutic Target	Protein Kinase	NUAK1	NUAK family SNF1-like kinase 1	O60285	CHEMBL5784
Therapeutic Target	Protein Kinase	KDR	Vascular endothelial growth factor receptor 2	P35968	CHEMBL279
Therapeutic Target	Protein Kinase	EGFR	Epidermal growth factor receptor erbB1	P00533	CHEMBL203
Drug Transporter	SLC superfamily of solute carriers	SLC22A6	Solute carrier family 22 member 6	Q4U2R8	CHEMBL1641347
Therapeutic Target	Small molecule receptor (family A GPCR)	GPR35	G-protein coupled receptor 35	Q9HC97	CHEMBL1293267
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD1	Dopamine D1 receptor	P21728	CHEMBL2056
Therapeutic Target	Transcription factor	SMAD3	Mothers against decapentaplegic homolog 3	P84022	CHEMBL1293258
Therapeutic Target	Transcription factor	AHR	Aryl hydrocarbon receptor	P35869	CHEMBL3201
Therapeutic Target	Transferase	POLI	DNA polymerase iota	Q9UNA4	CHEMBL5391
Therapeutic Target	Transferase	POLH	DNA polymerase eta	Q9Y253	CHEMBL5542

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	2

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT04011618	Effect of Ellagic Ácid on the Components of Metabolic Syndrome, Insulin Sensitivity and Insulin Secretion	metabolic syndrome	Ellagic Acid (NPC178134)	NP level
NCT00455416	Dietary Intervention in Follicular Lymphoma	follicular lymphoma	Ellagic Acid (NPC178134)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	ELAVL3,ACHE,GPR35,HPGD,CA14,CYP1A1,CA2,CYP2C9,KDM4E
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	TOP2A,CA7,SNCA,CA12,MET,DPP4,GLO1,HPGD,HSD17B2
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	NUAK1,TOP2A,CA12,GPR35,SRC,IGF1R,L3MBTL1,AKR1B1
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	TYR,ACHE,TOP2A,MET,CYP2C9,TOP2A,GPR35,F2
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	SLC22A6,TOP2A,CA12,GPR35,L3MBTL1,CA12,TOP2A,SRC
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CSNK2A3,CYP1B1,CA12,POLH,MET,KDR,DPP4,CA2
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	ACHE,TOP2A,CA7,GPR35,CA12,CYP2C9,F2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	TOP2A,GPR35,CYP1A1,CA2,CYP2C9,F2,HSD17B2
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	TOP2A,MET,INSR,SNCA,KDR,ACHE
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	HSPA1B,TOP2A,HSPA1A,KDR,MET,EGFR
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	TOP2A,MET,KDR,EGFR,IGF1R,CSNK2A1
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	ELAVL3,ACHE,SNCA,MET,CA14,CA2
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	ACHE,SNCA,SRC,INSR,DPP4,CA2
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	TOP2A,CA12,CYP1A2,MET,CYP1A1,CA2
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	KDR,IGF1R,EGFR,TOP2A,MET
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	IGF1R,KDR,EGFR,TOP2A,MET
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	IGF1R,INSR,KDR,AHR,SRC
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA14,CA2,TOP2A,CA12,CYP2C9
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	KDR,EGFR,TOP2A,MET,SRC
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	TOP2A,CA7,CA12,CYP2C9,F2
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	TOP2A,CYP1A2,CYP2C9,CA2,AKR1B1
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA7,CA12,CYP1B1,MET,DPP4
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	SNCA,DRD1,SRC,ACHE
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ACHE,AKR1B1,IGF1R,INSR
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	KDR,MET,EGFR,TYR
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	EGFR,SRC,TOP2A,IGF1R
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	CA2,MET,ACHE,AKR1B1
Malignant digestive organ neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C11	KDR,HSPA1B,HSPA1A,SRC
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	DPP4,KDR,INSR,AKR1B1
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	TOP2A,SRC,KDR,MET
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	SRC,MET,F2,KDR
Motor neuron disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B60	SRC,HSPA1B,HSPA1A,IGF1R
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	TOP2A,MET,F2,DRD1
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	TYR,MET,CYP1A1,F2
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	EGFR,MET,KDR
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	EGFR,AHR,KDR
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	IGF1R,APEX1,TEK
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	KDR,EGFR,MET
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	TOP2A,SRC,PIM1
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2,AHR,KDR
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	DPP4,SRC,TOP2A
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	KDR,MET,EGFR
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	AKR1B1,HSPA1B,HSPA1A
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F2,AKR1B1,TOP2A
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	KDR,MET,EGFR
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	TEK,MET,DPP4
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	DPP4,TOP2A,AHR
Diabetic foot ulcer Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD54	HSPA1B,EGFR,HSPA1A
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	HSPA1A,HSPA1B,SRC
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	INSR,F2,DPP4
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	MET,KDR,SRC
Herpes simplex infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F00	HSPA1B,HSPA1A,SMAD3
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	TOP2A,SRC,F2
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12,HSD17B2,TOP2A
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	HPGD,CYP1A1,TOP2A
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	ACHE,MET,DPP4
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	HSPA1A,ACHE,TOP2A
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	ELAVL3,TOP2A,CA12
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	CYP1B1,DPP4,SMAD3
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	HSD17B2,MET,ACHE
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	TOP2A,CA7,GALNT2,SRC,DPP4,DRD1,HSD17B2,RECQL,AHR,EGFR,CSNK2A2,POLH,APEX1,CASP6,SNCA,MET,PIM1,TYR,CA12,TDP1,HPGD,KDR
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	CSNK2A1,ACHE,TOP2A,CISD1,SRC,RECQL,AHR,TEK,EGFR,CSNK2A2,HSD17B10,POLH,APEX1,CASP6,NUAK1,MET,CA12,TDP1,GLO1,KDR,AKR1B1
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	ACHE,DPP4,DRD1,HSD17B2,AHR,TEK,CYP2C9,F2,SMAD3,CASP6,NUAK1,SLC22A6,SNCA,MET,CA12,HPGD,GLO1,CA14,KDR,AKR1B1
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	KDR,EGFR
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE,DRD1
Unspecific body region injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND56	EGFR,MET
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	TOP2A,F2
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	TOP2A,EGFR
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	SRC,TEK
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	INSR,DRD1
Ischemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B10-8B11	EGFR,SRC
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	DPP4,INSR
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	CA2,AKR1B1
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	AKR1B1,DRD1
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	TEK,TOP2A
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	DPP4,F2
Follicular lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A80	TOP2A NCT00455416
Metastatic malignant neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E09	HSPA1A,HSPA1B
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2,EGFR
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA2,CA12
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	SRC,KDR
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	DPP4 NCT04011618
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	SRC,EGFR
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	MET,KDR
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	KDR,SRC
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	PIM1,CYP2C9
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	SMAD3,ACHE
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	DPP4,AKR1B1
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F2,CA14
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA12,TOP2A
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	CYP1A1,ACHE
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	GPR35,EGFR
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	HPGD,POLH
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	GPR35,MET
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	NUAK1,TEK,ACHE,CA7,CISD1,CYP1B1,SNCA,MET,POLB,DPP4,CA14,CA2,CYP2C9,F2,PIM1,DRD1,HSD17B2,RECQL
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CA2,TOP2A,POLB,HSPA1B,APEX1,SRC,CA12,CSNK2A1,EGFR,HSPA1A,PIM1,IGF1R,TEK,AHR,MET,KDR,CA14
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	TOP2A,CA7,CISD1,GALNT2,POLB,DPP4,CA2,HSD17B2,ELAVL3,HSD17B10,CASP6,MET,TDP1,GLO1,CA14,AKR1B1
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CSNK2A1,CISD1,CA2,HSD17B2,AHR,ELAVL3,POLH,APEX1,CASP6,MET,CSNK2A3,CA12,CYP1A2,TDP1,GLO1,HPGD
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	APEX1,ACHE,CISD1,CYP1B1,GALNT2,HSD17B10,DPP4,HPGD,CYP2C9,DRD1,HSD17B2,AKR1B1
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CSNK2A1,NUAK1,ELAVL3,CSNK2A3,TOP2A,GPR35,SRC,IGF1R,L3MBTL1,SMAD3,AKR1B1
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	MET,CA2,CA14,KDR,EGFR,CA12,SRC,TOP2A,TEK,IGF1R
Chemoprotection Disease Category: NA Disease ICD-11 Code: N.A.	TOP2A
Type-1/2 diabete Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A10-5A11	INSR
Duodenal ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA63	CA2
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	IGF1R
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	IGF1R
NA Disease Category: NA Disease ICD-11 Code: NA	MET
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	F2
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	TYR
Liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB90-DB9Z	MET
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	CA2
Intracerebral haemorrhage Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B00	EGFR
Skin postprocedural disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EL8Y	EGFR
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	INSR
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	SRC
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	TOP2A
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	EGFR
Synovial sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5A	SRC
Common warts Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E80	TOP2A
Metastatic biliary tract neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C14-2C17	EGFR
Malignant mesenchymal neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5D-2B5Y	EGFR
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Autonomic nervous system disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8D87	SNCA
Epidermal dysplasias Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK90	SRC
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
HIV-infected patients with tuberculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1B10-1B14	TOP2A
Urinary tract infection Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GC08	TOP2A
Multiple structural anomalies syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2F	IGF1R
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CA2
Extraocular muscle disorder Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C82	IGF1R
Allergic/hypersensitivity disorder Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A80-4A8Z	DRD1
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	EGFR
Cervical cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C77	SRC
Inborn metabolism deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5C59	CA14
Syphilis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A61-1A6Z	TOP2A
Colon cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	EGFR
Respiratory system disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB40-CB7Z	TOP2A
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	SRC
Lysosomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C56	INSR
Testicular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80	EGFR
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Biliary tract cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C17	MET
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Abortion Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA00	DRD1
Otitis media Disease Category: 10.Diseases of the ear or mastoid process Disease ICD-11 Code: AA80-AB0Z	TOP2A
Acquired hypermelanosis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED60	TYR
Bladder cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	TOP2A
Ureteral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C92	AHR
Spinal cord/cranial nerve neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A02	EGFR
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	SRC
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F2
Fallopian tube cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C74	SRC
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Metastatic digestive system neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D8Y	SRC
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	CA2
Kaposi sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B57	TOP2A
Ocular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D00-2D07	APEX1
Anogenital warts Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A95	TOP2A
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Digestive organ benign neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E92	KDR
Otitis externa Disease Category: 10.Diseases of the ear or mastoid process Disease ICD-11 Code: AA00-AA13	TOP2A
Ischemic heart disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40-BA6Z	MET
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	CA2
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	DRD1
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Leiomyosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B58	SRC
Cocaine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C45	DRD1
Gonococcal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A70-1A7Z	TOP2A
Urethral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C93	EGFR
Hypopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6D	EGFR
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	AHR
Thyrotoxicosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A02	IGF1R
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	GLO1
Tic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A05	DRD1
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CYP1A1
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	F2
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	IGF1R
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	DPP4
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CYP1A1
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	MET
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AHR

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Populus Angustifolia

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

25 All known Ingredients in Total

10 Ingredients with Acceptable Bioavailablity

17 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Cytomegaloviral disease

Malignant neoplasms of adrenal gland

Hepatoblastoma

Other specified malignant neoplasms of kidney, except renal pelvis

Hepatocellular carcinoma of liver

Glioblastoma of brain

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Alzheimer disease

Stomach cancer

Liver cancer

Pheochromocytoma

Superficial ovarian endometriosis

Renal cell carcinoma, chromophobe type

Colorectal cancer

Lung cancer

Multiple myeloma

Bacterial infection

Brain cancer

Squamous cell carcinoma of bronchus or lung

Urothelial carcinoma of bladder

Malignant neoplasms of thyroid gland, unspecified

Parkinsonism

Pain, unspecified

Melanoma

Pancreatic cancer

Glaucoma

Malignant digestive organ neoplasm

Acute diabete complication

Ovarian cancer

Cardiovascular disease

Motor neuron disease

Adenocarcinoma of stomach

Other specified malignant neoplasms ofcolon

Renal cell carcinoma

Myelodysplastic syndrome

Retinopathy

Non-small cell lung cancer

Acute myeloid leukaemia

Thrombocytopenia

Malignant haematopoietic neoplasm

Metastatic lymph node neoplasm

Neuropathy

Thrombosis

Head and neck cancer

Chronic arterial occlusive disease

Psoriasis

Diabetic foot ulcer

BCR-ABL1-negative chronic myeloid leukaemia

Type 2 diabetes mellitus

Pleomorphic sarcoma

Herpes simplex infection

Multiple sclerosis

Osteoarthritis, unspecified

Myotonic dystrophy

West Nile virus infection

Malignant neoplasms of oesophagus

Invasive carcinoma of breast

Carpal tunnel syndrome

Ebola virus disease

Mesothelioma of pleura

Diffuse large B-cell lymphomas

Germ cell tumour of testis

Chronic pain