• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Anagallis Monelli


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

AACGCGTCGCCCTCCCCACCCTNTCGNGGAGGGGGCGGATACTGGCTCCCCGTACGCCCCGCGTGCGGTCGGCCTAAAAGCGAGTCCCGACGATCGAAGTCGTGGCAATTGGTGGTTGTAAAATGCCGTTTCTCTTTGTCGCGCGCTTCCTTCGGTACGGTTGGCTCCCTGACCCTGAAGCTCCATGCATTTGGTGCCTCGATCGCG
Taxonomic Information

Plant ID: NPO21404
Plant Latin Name: Anagallis Monelli
Taxonomy Genus: Anagallis
Taxonomy Family: Primulaceae

Plant External Links:

NCBI TaxonomyDB: 306291
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Tunisia

Traditional Medicine System:

Geographical Distribution

Tunisia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

24 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


23 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

13 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98911

Ingredient ID: NPC91820

Ingredient ID: NPC91815

Ingredient ID: NPC82426

Ingredient ID: NPC6530

Ingredient ID: NPC300061

Ingredient ID: NPC292093

Ingredient ID: NPC285776

Ingredient ID: NPC278525

Ingredient ID: NPC251738

Ingredient ID: NPC244208

Ingredient ID: NPC242913

Ingredient ID: NPC22928

Ingredient ID: NPC228346

Ingredient ID: NPC212806

Ingredient ID: NPC210434

Ingredient ID: NPC206800

Ingredient ID: NPC201591

Ingredient ID: NPC192979

Ingredient ID: NPC181296

Ingredient ID: NPC172525

Ingredient ID: NPC136962

Ingredient ID: NPC127491

Ingredient ID: NPC11100