• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Punica Granatum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GATCATTGTCGAGACCTGCGCGGCAGAACGACCCGAGAACCAGCGCTCCAAATGGGCCGGGGTCCCCCGGCCGCCGGGATGGCGGGGGCGCGCTTCGTCGCCTTTCCCGTCCCGGTCGTACAGTGTAAAACCCCGGCGCGGAAGGCGCCAAGGATCAGAAACAGGAGAGGCACGCCGCCCGCCTGAGGGACCGTGCAGTCTCGTGCGTAACCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCCTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCAAAACCTCCACGCCCTCGTCATCCATCCCTCGGGGGGGATGAGGGGGGGTGCGTGGCCGCTATGGGCGCGGAAGTTGGCCTCCCGTGGCACACCGCTGCGGCTGGCCCAAAAAGGAGCACGGGAGCGACGCGCTCCGCGGCGCGCGGTGGCGGCAGTACATGGCCCCTCGGGCATCCGTCCGGAGCCGTCCCTTCCGCGTTGCTCGGTGGCCTTCCATCCAAATAACGCGACCCCAGGTCAGGCGGGGCCACCCG

Click for details-----ITS1

GTGAACCTGCGGAAGGATCATTGTCGAGACCTGCGCGGCAGAACGACCCGAGAACCAGCCGCTCCAAATGGGCCGGGGTCCCCCGGCCGCCGGGATGGCGGGGGGCGCGCTTCGTCGCCTTTCCCGTCCCGGTCGTACAGTGTAAAACCCCGGCGCGGAAGGCGCCAAGGATCAGAAACAGGAGAGGCACGCCGCCCGCCTGAGGGACCGTGCAGTCTCGTGCGTAACCACAA

Click for details-----ITS2

ATCGCGTCGCCCCAAAACCTCCACGCCCTCGTCATCCATCCCTCGGGGGGGATGAGGGGGGGTGCGTGGCCGCTATGGGCGCGGAAGTTGGCCTCCCGTGGCACACCGCTGCGGCTGGCCCAAAAAGGAGCACGGGAGCGACGCGCTCCGCGGCGCGCGGTGGCGGCAGTACATGGCCCCTCGGGCATCCGTCCGGAGCCGTCCCTTCCGCGTTGCTCGGTGGCCTTCCATCCAAATAACGCGACCCCAGGTCAGGCGGGGCCACCCG
Taxonomic Information

Plant ID: NPO21349
Plant Latin Name: Punica Granatum
Taxonomy Genus: Punica
Taxonomy Family: Lythraceae

Plant External Links:

NCBI TaxonomyDB: 22663
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Madagascar; Italy; Turkmenistan; Rwanda; Swaziland; Argentina; Nigeria; Zimbabwe; Jordan; Thailand; Iraq; Philippines; Tanzania; Indonesia; United States; Angola; Mexico; Tunisia; South Africa; India; Malaysia; China; Greece; Sri Lanka; Kenya

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Antibacterial; Antidiarrhoeal; Antiviral; Astringent; Cardiac; Demulcent; Emmenagogue; Refrigerant; Stomachic; Vermifuge

Geographical Distribution

Turkey; Madagascar; Italy; Turkmenistan; Rwanda; Swaziland; Argentina; Nigeria; Zimbabwe; Jordan; Thailand; Iraq; Tanzania; Philippines; Indonesia; United States; Angola; Mexico; Tunisia; South Africa; India; Malaysia; China; Greece; Sri Lanka; Kenya

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

378 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


162 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

187 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99408

Ingredient ID: NPC97680

Ingredient ID: NPC97131

Ingredient ID: NPC9666

Ingredient ID: NPC94167

Ingredient ID: NPC92569

Ingredient ID: NPC92507

Ingredient ID: NPC91980

Ingredient ID: NPC91114

Ingredient ID: NPC88976

Ingredient ID: NPC88130

Ingredient ID: NPC88069

Ingredient ID: NPC87263

Ingredient ID: NPC86702

Ingredient ID: NPC86412

Ingredient ID: NPC86133

Ingredient ID: NPC85813

Ingredient ID: NPC85488

Ingredient ID: NPC85042

Ingredient ID: NPC84319

Ingredient ID: NPC82853

Ingredient ID: NPC81995

Ingredient ID: NPC81775

Ingredient ID: NPC81010

Ingredient ID: NPC8094

Ingredient ID: NPC79834

Ingredient ID: NPC79742

Ingredient ID: NPC78551

Ingredient ID: NPC77916

Ingredient ID: NPC76145

Ingredient ID: NPC7551

Ingredient ID: NPC75234

Ingredient ID: NPC75204

Ingredient ID: NPC74942

Ingredient ID: NPC74428

Ingredient ID: NPC72924

Ingredient ID: NPC72722

Ingredient ID: NPC7171

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC70744

Ingredient ID: NPC69445

Ingredient ID: NPC69289

Ingredient ID: NPC68779

Ingredient ID: NPC6773

Ingredient ID: NPC66052

Ingredient ID: NPC63941

Ingredient ID: NPC61477

Ingredient ID: NPC60151

Ingredient ID: NPC59581

Ingredient ID: NPC58190

Ingredient ID: NPC57863

Ingredient ID: NPC57495

Ingredient ID: NPC5447

Ingredient ID: NPC54264

Ingredient ID: NPC53028

Ingredient ID: NPC52622

Ingredient ID: NPC52607

Ingredient ID: NPC51700

Ingredient ID: NPC50629

Ingredient ID: NPC49983

Ingredient ID: NPC49151

Ingredient ID: NPC490481

Ingredient ID: NPC490469

Ingredient ID: NPC490434

Ingredient ID: NPC490429

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490420

Ingredient ID: NPC490407

Ingredient ID: NPC490406

Ingredient ID: NPC490375

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC48623

Ingredient ID: NPC486113

Ingredient ID: NPC46274

Ingredient ID: NPC44996

Ingredient ID: NPC44751

Ingredient ID: NPC446

Ingredient ID: NPC44260

Ingredient ID: NPC44083

Ingredient ID: NPC43918

Ingredient ID: NPC43696

Ingredient ID: NPC43357

Ingredient ID: NPC424

Ingredient ID: NPC41424

Ingredient ID: NPC40702

Ingredient ID: NPC40432

Ingredient ID: NPC40249

Ingredient ID: NPC38408

Ingredient ID: NPC38145

Ingredient ID: NPC380

Ingredient ID: NPC37793

Ingredient ID: NPC37502

Ingredient ID: NPC36061

Ingredient ID: NPC34764

Ingredient ID: NPC34241

Ingredient ID: NPC34103

Ingredient ID: NPC33611

Ingredient ID: NPC3357

Ingredient ID: NPC32977

Ingredient ID: NPC3295

Ingredient ID: NPC328447

Ingredient ID: NPC322523

Ingredient ID: NPC32089

Ingredient ID: NPC318552

Ingredient ID: NPC311907

Ingredient ID: NPC31039

Ingredient ID: NPC31034

Ingredient ID: NPC307628

Ingredient ID: NPC307063

Ingredient ID: NPC307050

Ingredient ID: NPC305959

Ingredient ID: NPC302857

Ingredient ID: NPC302436

Ingredient ID: NPC302327

Ingredient ID: NPC301950

Ingredient ID: NPC301585

Ingredient ID: NPC301515

Ingredient ID: NPC300790

Ingredient ID: NPC300564

Ingredient ID: NPC300049

Ingredient ID: NPC29883

Ingredient ID: NPC297732

Ingredient ID: NPC296337

Ingredient ID: NPC295417

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293908

Ingredient ID: NPC293378

Ingredient ID: NPC293343

Ingredient ID: NPC292450

Ingredient ID: NPC291957

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC289196

Ingredient ID: NPC288537

Ingredient ID: NPC287965

Ingredient ID: NPC285839

Ingredient ID: NPC285047

Ingredient ID: NPC283956

Ingredient ID: NPC283655

Ingredient ID: NPC282858

Ingredient ID: NPC281570

Ingredient ID: NPC280945

Ingredient ID: NPC280749

Ingredient ID: NPC280500

Ingredient ID: NPC279453

Ingredient ID: NPC279121

Ingredient ID: NPC278642

Ingredient ID: NPC278068

Ingredient ID: NPC27657

Ingredient ID: NPC276349

Ingredient ID: NPC275462

Ingredient ID: NPC274613

Ingredient ID: NPC272123

Ingredient ID: NPC269919

Ingredient ID: NPC269783

Ingredient ID: NPC269440

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC26861

Ingredient ID: NPC268342

Ingredient ID: NPC268266

Ingredient ID: NPC267627

Ingredient ID: NPC26703

Ingredient ID: NPC266020

Ingredient ID: NPC26536

Ingredient ID: NPC265305

Ingredient ID: NPC265273

Ingredient ID: NPC264711

Ingredient ID: NPC264317

Ingredient ID: NPC264145

Ingredient ID: NPC261831

Ingredient ID: NPC261619

Ingredient ID: NPC259838

Ingredient ID: NPC259533

Ingredient ID: NPC259182

Ingredient ID: NPC258733

Ingredient ID: NPC258672

Ingredient ID: NPC257980

Ingredient ID: NPC257090

Ingredient ID: NPC255833

Ingredient ID: NPC255662

Ingredient ID: NPC254994

Ingredient ID: NPC252833

Ingredient ID: NPC251791

Ingredient ID: NPC25162

Ingredient ID: NPC249823

Ingredient ID: NPC248956

Ingredient ID: NPC24858

Ingredient ID: NPC247786

Ingredient ID: NPC247713

Ingredient ID: NPC246679

Ingredient ID: NPC245852

Ingredient ID: NPC2458

Ingredient ID: NPC244061

Ingredient ID: NPC243728

Ingredient ID: NPC243083

Ingredient ID: NPC242895

Ingredient ID: NPC242580

Ingredient ID: NPC242413

Ingredient ID: NPC239039

Ingredient ID: NPC237898

Ingredient ID: NPC237643

Ingredient ID: NPC237224

Ingredient ID: NPC237202

Ingredient ID: NPC236709

Ingredient ID: NPC231687

Ingredient ID: NPC230301

Ingredient ID: NPC229608

Ingredient ID: NPC228914

Ingredient ID: NPC228346

Ingredient ID: NPC227030

Ingredient ID: NPC225710

Ingredient ID: NPC225585

Ingredient ID: NPC224116

Ingredient ID: NPC222001

Ingredient ID: NPC221758

Ingredient ID: NPC220831

Ingredient ID: NPC220825

Ingredient ID: NPC220765

Ingredient ID: NPC220724

Ingredient ID: NPC220505

Ingredient ID: NPC219876

Ingredient ID: NPC219600

Ingredient ID: NPC219092

Ingredient ID: NPC218860

Ingredient ID: NPC217781

Ingredient ID: NPC217586

Ingredient ID: NPC216630

Ingredient ID: NPC214584

Ingredient ID: NPC213749

Ingredient ID: NPC213391

Ingredient ID: NPC213352

Ingredient ID: NPC211802

Ingredient ID: NPC211550

Ingredient ID: NPC209970

Ingredient ID: NPC208553

Ingredient ID: NPC20791

Ingredient ID: NPC206459

Ingredient ID: NPC205037

Ingredient ID: NPC202713

Ingredient ID: NPC201844

Ingredient ID: NPC20045

Ingredient ID: NPC199379

Ingredient ID: NPC19783

Ingredient ID: NPC19757

Ingredient ID: NPC197356

Ingredient ID: NPC196336

Ingredient ID: NPC195874

Ingredient ID: NPC195615

Ingredient ID: NPC195491

Ingredient ID: NPC195196

Ingredient ID: NPC195019

Ingredient ID: NPC192638

Ingredient ID: NPC192402

Ingredient ID: NPC192065

Ingredient ID: NPC191306

Ingredient ID: NPC190810

Ingredient ID: NPC190501

Ingredient ID: NPC190454

Ingredient ID: NPC19044

Ingredient ID: NPC189436

Ingredient ID: NPC189224

Ingredient ID: NPC188238

Ingredient ID: NPC187993

Ingredient ID: NPC187838

Ingredient ID: NPC187770

Ingredient ID: NPC185776

Ingredient ID: NPC184571

Ingredient ID: NPC184171

Ingredient ID: NPC183672

Ingredient ID: NPC181823

Ingredient ID: NPC179548

Ingredient ID: NPC178383

Ingredient ID: NPC178134

Ingredient ID: NPC17810

Ingredient ID: NPC177112

Ingredient ID: NPC176740

Ingredient ID: NPC176326

Ingredient ID: NPC175854

Ingredient ID: NPC175793

Ingredient ID: NPC175013

Ingredient ID: NPC173996

Ingredient ID: NPC173977

Ingredient ID: NPC169749

Ingredient ID: NPC169022

Ingredient ID: NPC168707

Ingredient ID: NPC168636

Ingredient ID: NPC168623

Ingredient ID: NPC168579

Ingredient ID: NPC1682

Ingredient ID: NPC167976

Ingredient ID: NPC167400

Ingredient ID: NPC166851

Ingredient ID: NPC165967

Ingredient ID: NPC165382

Ingredient ID: NPC165159

Ingredient ID: NPC164614

Ingredient ID: NPC163527

Ingredient ID: NPC162742

Ingredient ID: NPC161557

Ingredient ID: NPC16024

Ingredient ID: NPC159334

Ingredient ID: NPC158079

Ingredient ID: NPC157340

Ingredient ID: NPC157298

Ingredient ID: NPC156654

Ingredient ID: NPC15658

Ingredient ID: NPC155825

Ingredient ID: NPC15538

Ingredient ID: NPC153572

Ingredient ID: NPC153031

Ingredient ID: NPC150958

Ingredient ID: NPC150950

Ingredient ID: NPC149184

Ingredient ID: NPC147983

Ingredient ID: NPC146197

Ingredient ID: NPC146066

Ingredient ID: NPC144109

Ingredient ID: NPC143851

Ingredient ID: NPC142753

Ingredient ID: NPC142707

Ingredient ID: NPC142415

Ingredient ID: NPC141765

Ingredient ID: NPC14030

Ingredient ID: NPC13991

Ingredient ID: NPC139622

Ingredient ID: NPC139520

Ingredient ID: NPC139029

Ingredient ID: NPC138113

Ingredient ID: NPC13768

Ingredient ID: NPC137480

Ingredient ID: NPC136232

Ingredient ID: NPC136014

Ingredient ID: NPC135222

Ingredient ID: NPC131981

Ingredient ID: NPC131766

Ingredient ID: NPC130683

Ingredient ID: NPC130577

Ingredient ID: NPC129533

Ingredient ID: NPC129530

Ingredient ID: NPC128626

Ingredient ID: NPC126759

Ingredient ID: NPC126134

Ingredient ID: NPC126029

Ingredient ID: NPC125352

Ingredient ID: NPC125136

Ingredient ID: NPC125091

Ingredient ID: NPC124639

Ingredient ID: NPC123259

Ingredient ID: NPC121162

Ingredient ID: NPC120503

Ingredient ID: NPC119952

Ingredient ID: NPC119289

Ingredient ID: NPC119107

Ingredient ID: NPC117724

Ingredient ID: NPC116775

Ingredient ID: NPC115281

Ingredient ID: NPC115216

Ingredient ID: NPC115207

Ingredient ID: NPC114239

Ingredient ID: NPC114161

Ingredient ID: NPC113776

Ingredient ID: NPC113733

Ingredient ID: NPC112147

Ingredient ID: NPC111888

Ingredient ID: NPC111255

Ingredient ID: NPC109878

Ingredient ID: NPC108811

Ingredient ID: NPC108455

Ingredient ID: NPC1075

Ingredient ID: NPC105036

Ingredient ID: NPC104281

Ingredient ID: NPC104222

Ingredient ID: NPC101324