• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Lonicera Hypoglauca


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATTGCGTCGCCCCCCCACCCCGCTTCCCACAGGGTTGCGAGCGGTGGGGGGTGTGGACAATGGCCTCCCGAGCCCCCGGGCGCGGATGGCCCAAAATTGAGTCCTCGGCGGCGGACGTCACGACGAGTGGTGGTCGTAACATTCCTCTTATCACGTTGTGCGGTTCCCCGTCGCTCGGGCGACCAAGTGACCCTGACGCGTCGTCGTACGACGGCGCTCCGA
Taxonomic Information

Plant ID: NPO21345
Plant Latin Name: Lonicera Hypoglauca
Taxonomy Genus: Lonicera
Taxonomy Family: Caprifoliaceae

Plant External Links:

NCBI TaxonomyDB: 638626
Plant-of-the-World-Online: 148833-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

Japan; Taiwan; Nepal; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

81 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


23 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

40 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95164

Ingredient ID: NPC92774

Ingredient ID: NPC92531

Ingredient ID: NPC88789

Ingredient ID: NPC87425

Ingredient ID: NPC83706

Ingredient ID: NPC81775

Ingredient ID: NPC77249

Ingredient ID: NPC68889

Ingredient ID: NPC51700

Ingredient ID: NPC37331

Ingredient ID: NPC35185

Ingredient ID: NPC34125

Ingredient ID: NPC328670

Ingredient ID: NPC326250

Ingredient ID: NPC325762

Ingredient ID: NPC324807

Ingredient ID: NPC324278

Ingredient ID: NPC323515

Ingredient ID: NPC321778

Ingredient ID: NPC320172

Ingredient ID: NPC317462

Ingredient ID: NPC307699

Ingredient ID: NPC302857

Ingredient ID: NPC302856

Ingredient ID: NPC301317

Ingredient ID: NPC301049

Ingredient ID: NPC297517

Ingredient ID: NPC295492

Ingredient ID: NPC294902

Ingredient ID: NPC292764

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC288537

Ingredient ID: NPC281131

Ingredient ID: NPC279121

Ingredient ID: NPC278068

Ingredient ID: NPC272037

Ingredient ID: NPC270768

Ingredient ID: NPC264711

Ingredient ID: NPC255662

Ingredient ID: NPC255042

Ingredient ID: NPC251551

Ingredient ID: NPC24146

Ingredient ID: NPC237314

Ingredient ID: NPC232954

Ingredient ID: NPC230301

Ingredient ID: NPC226794

Ingredient ID: NPC224389

Ingredient ID: NPC222241

Ingredient ID: NPC217853

Ingredient ID: NPC216630

Ingredient ID: NPC213935

Ingredient ID: NPC21344

Ingredient ID: NPC210040

Ingredient ID: NPC208075

Ingredient ID: NPC20791

Ingredient ID: NPC206095

Ingredient ID: NPC205003

Ingredient ID: NPC189142

Ingredient ID: NPC182840

Ingredient ID: NPC180871

Ingredient ID: NPC179950

Ingredient ID: NPC177013

Ingredient ID: NPC176740

Ingredient ID: NPC17250

Ingredient ID: NPC170526

Ingredient ID: NPC167976

Ingredient ID: NPC16728

Ingredient ID: NPC15336

Ingredient ID: NPC150770

Ingredient ID: NPC142703

Ingredient ID: NPC142415

Ingredient ID: NPC139546

Ingredient ID: NPC13818

Ingredient ID: NPC135088

Ingredient ID: NPC130683

Ingredient ID: NPC117596

Ingredient ID: NPC115674

Ingredient ID: NPC112834

Ingredient ID: NPC1075