• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Artemisia Dracunculus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCCTGCAAAGCAGAACGACCCGTGAACGCGTAAAAACAACCGAGTGTYGTTTGGATCAAGCGCTTGTTTGATCCTCTCGACGCTTTGTCGATGTGCGTTYGCTCGAGTTCCTCTGGACCTCGTGTGAATGTCATCGGCGCACTAACAACCCCCGGCACAATGTGTGCCAAGGAAAACTAAACTCAAGAAGGCTCGTTTCGTGTAGCCCCGTTCGCGGTGCGCTCATGGGACGCGGCTTCTTYATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCACAACTCTCCGTAAAGGGAACTTGTGTTTTGGGGGCGGATATTGGTCTCCCGTGCTCATGGCGTGGTTGGCCGAAATAGGAGTCCCTCCGRTGGACGCACGAACTAGTGGTGGTCGTAAAAACCCTCGTCTTTTGTTTCGTGCTGTTAGTCGCGAGGGAAACTCTTTAAAAACCCAAATGTGTCGTCTCTTGACGGCGCTTCGA

Click for details-----ITS1

TCGAACCCTGCAAAGCAGAACGACCCGTGAACGCGTAAAAACAACCGAGTGTYGTTTGGATCAAGCGCTTGTTTGATCCTCTCGACGCTTTGTCGATGTGCGTTYGCTCGAGTTCCTCTGGACCTCGTGTGAATGTCATCGGCGCACTAACAACCCCCGGCACAATGTGTGCCAAGGAAAACTAAACTCAAGAAGGCTCGTTTCGTGTAGCCCCGTTCGCGGTGCGCTCATGGGACGCGGCTTCTTYATAATCACAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO21334
Plant Latin Name: Artemisia Dracunculus
Taxonomy Genus: Artemisia
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 72341
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Switzerland; China; India

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Antiscorbutic; Appetizer; Diuretic; Emmenagogue; Febrifuge; Hypnotic; Odontalgic; Stomachic; Vermifuge

Geographical Distribution

Switzerland; India; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

126 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


108 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

74 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC94167

Ingredient ID: NPC92943

Ingredient ID: NPC92869

Ingredient ID: NPC91475

Ingredient ID: NPC90486

Ingredient ID: NPC85210

Ingredient ID: NPC83187

Ingredient ID: NPC74539

Ingredient ID: NPC74384

Ingredient ID: NPC73980

Ingredient ID: NPC72042

Ingredient ID: NPC71853

Ingredient ID: NPC71339

Ingredient ID: NPC70691

Ingredient ID: NPC65134

Ingredient ID: NPC60173

Ingredient ID: NPC55412

Ingredient ID: NPC53559

Ingredient ID: NPC502

Ingredient ID: NPC49074

Ingredient ID: NPC489907

Ingredient ID: NPC474157

Ingredient ID: NPC46634

Ingredient ID: NPC46254

Ingredient ID: NPC43246

Ingredient ID: NPC38742

Ingredient ID: NPC38212

Ingredient ID: NPC33415

Ingredient ID: NPC32991

Ingredient ID: NPC32441

Ingredient ID: NPC312800

Ingredient ID: NPC31279

Ingredient ID: NPC312132

Ingredient ID: NPC311783

Ingredient ID: NPC311255

Ingredient ID: NPC31090

Ingredient ID: NPC308744

Ingredient ID: NPC302857

Ingredient ID: NPC29883

Ingredient ID: NPC296071

Ingredient ID: NPC294902

Ingredient ID: NPC292792

Ingredient ID: NPC28828

Ingredient ID: NPC287331

Ingredient ID: NPC283170

Ingredient ID: NPC279121

Ingredient ID: NPC279026

Ingredient ID: NPC272524

Ingredient ID: NPC269919

Ingredient ID: NPC269242

Ingredient ID: NPC269023

Ingredient ID: NPC265305

Ingredient ID: NPC264784

Ingredient ID: NPC263089

Ingredient ID: NPC261644

Ingredient ID: NPC259134

Ingredient ID: NPC258476

Ingredient ID: NPC257124

Ingredient ID: NPC252587

Ingredient ID: NPC2517

Ingredient ID: NPC251666

Ingredient ID: NPC247553

Ingredient ID: NPC246558

Ingredient ID: NPC246165

Ingredient ID: NPC244315

Ingredient ID: NPC240722

Ingredient ID: NPC239039

Ingredient ID: NPC235260

Ingredient ID: NPC235190

Ingredient ID: NPC232375

Ingredient ID: NPC232141

Ingredient ID: NPC230775

Ingredient ID: NPC225709

Ingredient ID: NPC216825

Ingredient ID: NPC214971

Ingredient ID: NPC210456

Ingredient ID: NPC210092

Ingredient ID: NPC209632

Ingredient ID: NPC20791

Ingredient ID: NPC205649

Ingredient ID: NPC204388

Ingredient ID: NPC202992

Ingredient ID: NPC201844

Ingredient ID: NPC200838

Ingredient ID: NPC195355

Ingredient ID: NPC191103

Ingredient ID: NPC19003

Ingredient ID: NPC187770

Ingredient ID: NPC182840

Ingredient ID: NPC182468

Ingredient ID: NPC181715

Ingredient ID: NPC179987

Ingredient ID: NPC17810

Ingredient ID: NPC176819

Ingredient ID: NPC176740

Ingredient ID: NPC176309

Ingredient ID: NPC175771

Ingredient ID: NPC173996

Ingredient ID: NPC172625

Ingredient ID: NPC167400

Ingredient ID: NPC163984

Ingredient ID: NPC157340

Ingredient ID: NPC152384

Ingredient ID: NPC150950

Ingredient ID: NPC147983

Ingredient ID: NPC145463

Ingredient ID: NPC13990

Ingredient ID: NPC138113

Ingredient ID: NPC137949

Ingredient ID: NPC13755

Ingredient ID: NPC13449

Ingredient ID: NPC13304

Ingredient ID: NPC13143

Ingredient ID: NPC130306

Ingredient ID: NPC125085

Ingredient ID: NPC125062

Ingredient ID: NPC117299

Ingredient ID: NPC116775

Ingredient ID: NPC115919

Ingredient ID: NPC114594

Ingredient ID: NPC111888

Ingredient ID: NPC111690

Ingredient ID: NPC110899

Ingredient ID: NPC104190

Ingredient ID: NPC100773