• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Syzygium Samarangense


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCCTAGCAGAATGACCAGAGAACCGGTAACAAACTCAATGGGGACGGTGGGCCTCGCCCAACGTCCCCAGACGCTTGGATGGCACGGGTGCCTACGGGCTCTCGGGCTTTTTCTCGGCGGCACAACGAACCCCGGCGCGGAATGCGCCAAGGAACTTGAACAAGAGAGCGATGCTCCCGCCGCCCCAGACAAGGTGCGTGCGCGGGATGCCATGCGATCTCCTATTATTCATAACGACTCCCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAACTGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCGGCTTAGGGCACGTTTGCCTGGGTGTCACACATGGCGTTGCCCCTAACCCCTCGCCTTGAATTGGGCGGGCGGGACTTGGGCGCGTATGTTGGCCTCCCGAGATGACCTTATCCCGGTTGGCCTAAAATCGAGCGTTGGAGCGATTAGCACCACGACATTCGGTGGTTGATAAGACCCCAATGATCAATGTCGTGCGTGTCGCTCACGCACATGCTCCACGAATCTACCTTTCACCA

Click for details-----ITS1

CTGCGGAAGGATCATTGTCGAATCCTGCCTAGCAGAATGACCAGAGAACCGGTAACAAACTCAATGGGGACGGTGGGCCTCGCCCAACGTCCCCAGACGCTTGGATGGCACGGGTGCCTACGGGCTCTCGGGCTTTTTCTCGGCGGCACAACGAACCCCGGCGCGGAATGCGCCAAGGAACTTGAACAAGAGAGCGATGCTCCCGCCGCCCCAGACATGGTGCGTGCGCGGGATGCCATGCGATCTCCTATTATTCATAA

Click for details-----ITS2

ATGGCGTTGCCCCTAACCCCTCGCCTTGAATTGGGCGGGCGGGACTTGGGCGCGTATGTTGGCCTCCCGAGATGACCTTATCCCGGTTGGCCTAAAATCGAGCGTTGGAGCGATTAGCACCACGACATTCGGTGGTTGATAAGACCCCAATGATCAATGTCGTGCGTGTCGCTCACGCACATGCTCCACGAATCTACCTTTCACCA
Taxonomic Information

Plant ID: NPO21331
Plant Latin Name: Syzygium Samarangense
Taxonomy Genus: Syzygium
Taxonomy Family: Myrtaceae

Plant External Links:

NCBI TaxonomyDB: 260143
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
Indian Folk; TCM

Geographical Distribution

India; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

31 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


12 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99605

Ingredient ID: NPC92056

Ingredient ID: NPC88485

Ingredient ID: NPC68637

Ingredient ID: NPC66962

Ingredient ID: NPC61535

Ingredient ID: NPC58579

Ingredient ID: NPC57781

Ingredient ID: NPC55602

Ingredient ID: NPC37965

Ingredient ID: NPC305932

Ingredient ID: NPC290495

Ingredient ID: NPC27765

Ingredient ID: NPC257610

Ingredient ID: NPC248703

Ingredient ID: NPC248372

Ingredient ID: NPC233221

Ingredient ID: NPC230301

Ingredient ID: NPC223186

Ingredient ID: NPC219852

Ingredient ID: NPC207379

Ingredient ID: NPC195334

Ingredient ID: NPC172319

Ingredient ID: NPC163970

Ingredient ID: NPC158961

Ingredient ID: NPC150399

Ingredient ID: NPC149300

Ingredient ID: NPC14063

Ingredient ID: NPC13768

Ingredient ID: NPC133671

Ingredient ID: NPC131713