• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Plantago Major


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TAAACCTGTGGACACGTGTTTAACATGAACGTTGCCTCGTTGGGGTGGACCAATCCACTCTTCGTGACACCGTGCCTGCTCGGTGCTTGAACTTGGTGGGCTAACGAAACTTGGTGCGGCGAGCGCCAAGGAAAACAAAATGGAAACGTTGCTCCTCGTGACACCAGTTCGTGGTGTGGTTTTGGGGATGAGATGTATCTTGAAAGTCAAAACGACTCTCGGCAACTGATATCTCGGCTCTCGCATCAATGAAGAAAATAGCGAAATGCGATACTTGGTGTGAATTGTAGAAAATCATGAACCATTTAAACTTTGAATGCAAGTTGCGCCCGACGCCATCGGGCTGATGGCACACCTGCCTGGGCGTCACGCATCTTGGCTTCGCCTACACCAATTTGGTGCGGGGGCGGATAATGGCATCCCGTTAGCTGGGTTTGATAAAAAGAATTCGTCATCAATGGATGTCAAAACCAGTGGTGGATGAAAGATTATTGGTGGAGTTGAGCTTCACTCCGAAGCAAGCGAGGGCGGAACTACAAAACAATGGAGCTAACGCGCCTTAAAACGATACACAAAGTCAGACGGGAATACACGCTGAATTTCAGCATAAATAACCCGTATGAATAGCGCGAAGGGACGTACTTCT

Click for details-----ITS1

ATCATTGTCGATATCTAAAAAGTAGACCTGTGAACACGTGTTTAACATGAACGTTGCCTCGTTGGGCTGGAGTAATCCACTCTTCGTGGCATCGTGCCTGCCCGGTGCTTGCACTTGGTGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAAAATGGAAGCGTTGCTCCCCGTGACTCCCGTTCGCGGTGTGGTTTTGGGGATGTGATGTATCTTGAAAGTCAAAA

Click for details-----ITS2

ATCTTGGCTTCGCCTACACCAATTTGGTGCGGGGGCGGATAATGGCATCCCGTTAGCTGGGTTTGATAAAAAGAATTCGTCATCAATGGATGTCAAAACCAGTGGTGGATGAAAGATTATTGGTGGAGTTGAGCTTCACTCCGAAGCAAGCGAGGGCGGAACTACAAAACAATGGAGCTAACGCGCCTTAAAACGATACACAAAGTCAGACGGGAATACACGCTGAATTTCAGCATAAATAACCCGTATGAATAGCGCGAAGGGACGTACTTCT
Taxonomic Information

Plant ID: NPO21324
Plant Latin Name: Plantago Major
Taxonomy Genus: Plantago
Taxonomy Family: Plantaginaceae

Plant External Links:

NCBI TaxonomyDB: 29818
Plant-of-the-World-Online: 321286-2

Used in Medicines

Country/Region:
Turkey; Italy; Turkmenistan; Lebanon; Lithuania; Rwanda; Laos; China; Thailand; Philippines; Indonesia; Tanzania; Finland; United States; Sweden; Vietnam; Russia; Albania; Portugal; South Africa; India; Malaysia; Kenya

Traditional Medicine System:
Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Antidote; Astringent; Demulcent; Deobstruent; Depurative; Diuretic; Expectorant; Haemostatic; Laxative; Ophthalmic; Poultice; Refrigerant; Vermifuge

Geographical Distribution

Brazil; Canada; Italy; Peru; Lebanon; Lithuania; Costa Rica; Cambodia; France; Bahamas; Ethiopia; Netherlands; Tanzania; Ireland; Laos; Bolivia; Norway; Thailand; Ecuador; Turkmenistan; Belarus; Algeria; Cuba; Iceland; Venezuela; Malaysia; Cape Verde; Russia; United States; Trinidad and Tobago; Zimbabwe; China; Vietnam; Belgium; Germany; Dominican Republic; Belize; Poland; Spain; Ukraine; Eritrea; Indonesia; Pakistan; Denmark; Philippines; Finland; New Caledonia; Turkey; Mauritius; Morocco; Sweden; Seychelles; Namibia; Kenya; Switzerland; Honduras; Haiti; Bulgaria; Jamaica; Romania; Albania; Angola; Portugal; Mexico; Egypt; South Africa; India; United Kingdom; Lesotho; Austria; Rwanda; Tunisia; Colombia; Greece; Hungary; Fiji; Zambia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

106 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


60 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

55 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC89143

Ingredient ID: NPC86779

Ingredient ID: NPC86191

Ingredient ID: NPC85813

Ingredient ID: NPC81775

Ingredient ID: NPC81010

Ingredient ID: NPC76145

Ingredient ID: NPC73906

Ingredient ID: NPC73813

Ingredient ID: NPC72615

Ingredient ID: NPC70744

Ingredient ID: NPC62469

Ingredient ID: NPC60140

Ingredient ID: NPC51700

Ingredient ID: NPC50934

Ingredient ID: NPC4884

Ingredient ID: NPC479770

Ingredient ID: NPC477781

Ingredient ID: NPC477780

Ingredient ID: NPC477779

Ingredient ID: NPC477778

Ingredient ID: NPC477777

Ingredient ID: NPC477776

Ingredient ID: NPC45960

Ingredient ID: NPC43212

Ingredient ID: NPC41503

Ingredient ID: NPC3780

Ingredient ID: NPC331672

Ingredient ID: NPC328788

Ingredient ID: NPC325699

Ingredient ID: NPC323434

Ingredient ID: NPC323002

Ingredient ID: NPC316926

Ingredient ID: NPC316573

Ingredient ID: NPC316416

Ingredient ID: NPC312800

Ingredient ID: NPC304163

Ingredient ID: NPC30315

Ingredient ID: NPC302857

Ingredient ID: NPC301585

Ingredient ID: NPC301026

Ingredient ID: NPC300017

Ingredient ID: NPC29883

Ingredient ID: NPC29813

Ingredient ID: NPC294548

Ingredient ID: NPC289758

Ingredient ID: NPC288485

Ingredient ID: NPC287331

Ingredient ID: NPC279121

Ingredient ID: NPC278068

Ingredient ID: NPC277878

Ingredient ID: NPC277467

Ingredient ID: NPC275772

Ingredient ID: NPC274455

Ingredient ID: NPC270796

Ingredient ID: NPC264711

Ingredient ID: NPC264143

Ingredient ID: NPC261831

Ingredient ID: NPC251102

Ingredient ID: NPC249045

Ingredient ID: NPC24550

Ingredient ID: NPC243443

Ingredient ID: NPC241217

Ingredient ID: NPC241154

Ingredient ID: NPC241110

Ingredient ID: NPC234132

Ingredient ID: NPC224651

Ingredient ID: NPC222830

Ingredient ID: NPC216630

Ingredient ID: NPC215880

Ingredient ID: NPC209970

Ingredient ID: NPC206800

Ingredient ID: NPC205003

Ingredient ID: NPC197316

Ingredient ID: NPC196776

Ingredient ID: NPC195019

Ingredient ID: NPC1897

Ingredient ID: NPC189142

Ingredient ID: NPC188167

Ingredient ID: NPC188161

Ingredient ID: NPC187432

Ingredient ID: NPC181153

Ingredient ID: NPC176017

Ingredient ID: NPC173543

Ingredient ID: NPC171495

Ingredient ID: NPC170065

Ingredient ID: NPC169454

Ingredient ID: NPC165519

Ingredient ID: NPC154186

Ingredient ID: NPC142703

Ingredient ID: NPC142415

Ingredient ID: NPC137167

Ingredient ID: NPC136699

Ingredient ID: NPC134252

Ingredient ID: NPC131624

Ingredient ID: NPC127267

Ingredient ID: NPC120454

Ingredient ID: NPC117572

Ingredient ID: NPC114705

Ingredient ID: NPC114053

Ingredient ID: NPC112866

Ingredient ID: NPC111088

Ingredient ID: NPC110899

Ingredient ID: NPC107334

Ingredient ID: NPC105025

Ingredient ID: NPC100551