• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Angelica Keiskei


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCAATAGCAGAATGACCCGCCAACACGTTAACAATTTGGGCGAGCATCGGGGGGCCTCGGTCTCCTTTCTGCGAATCCCTGGTAGGTGGCTGCTCTCGGGTGGCCACTGGCCTGCAAAATCATTCGGGCGCGGAATGCGCCAAGGACCTTAAAACTGAATTGTACGTCCGTATCCCGTTAGCGGGCACCGGCGTCATTCCAAAACACAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCACTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACATCGTCTTGCCCACAAATCAATCACACCTGAGAAGTTGTGCCGGTTTGGGGCGATAACTGGCCTCCCGTACCTTGTCGTGCGGTTGGCGGAAAAATGAGTCTCCGGCGATGGACGTTGCGACATCGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGCGCGATTCCTGGTCATCTTAGCGAGCTCCAGGACCCTTAGGCAGCACACACTCTGTGCGCTTCTA

Click for details-----ITS1

TCGAATCCTGCAATAGCAGAATGACCCGCCAACACGTTAACAATTTGGGCGAGCATCGGGGGGCCTCGGTCTCCTTTCTGCGAATCCCTGGTAGGTGGCTGCTCTCGGGTGGCCACTGGCCTGCAAAATCATTCGGGCGCGGAATGCGCCAAGGACCTTAAAACTGAATTGTACGTCCGTATCCCGTTAGCGGGCACCGGCGTCATTCCAAAACACAA

Click for details-----ITS2

ATCGTCTTGCCCACAAATCAATCACACCTGAGAAGTTGTGCCGGTTTGGGGCGATAACTGGCCTCCCGTACCTTGTCGTGCGGTTGGCGGAAAAATGAGTCTCCGGCGATGGACGTTGCGACATCGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGCGCGATTCCTGGTCATCTTAGCGAGCTCCAGGACCCTTAGGCAGCACACACTCTGTGCGCTTCTA
Taxonomic Information

Plant ID: NPO21056
Plant Latin Name: Angelica Keiskei
Taxonomy Genus: Angelica
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 357850
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Indonesia; China

Traditional Medicine System:
TCM

Geographical Distribution

Indonesia; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

74 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


56 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

53 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC99991

Ingredient ID: NPC90172

Ingredient ID: NPC86908

Ingredient ID: NPC76251

Ingredient ID: NPC74539

Ingredient ID: NPC72158

Ingredient ID: NPC65532

Ingredient ID: NPC64393

Ingredient ID: NPC475042

Ingredient ID: NPC474998

Ingredient ID: NPC474772

Ingredient ID: NPC474744

Ingredient ID: NPC472424

Ingredient ID: NPC472423

Ingredient ID: NPC472422

Ingredient ID: NPC472421

Ingredient ID: NPC472420

Ingredient ID: NPC470211

Ingredient ID: NPC470210

Ingredient ID: NPC470089

Ingredient ID: NPC470087

Ingredient ID: NPC40507

Ingredient ID: NPC38473

Ingredient ID: NPC37333

Ingredient ID: NPC33320

Ingredient ID: NPC312881

Ingredient ID: NPC309138

Ingredient ID: NPC302440

Ingredient ID: NPC301089

Ingredient ID: NPC292834

Ingredient ID: NPC282907

Ingredient ID: NPC281131

Ingredient ID: NPC279121

Ingredient ID: NPC274109

Ingredient ID: NPC271282

Ingredient ID: NPC266689

Ingredient ID: NPC261526

Ingredient ID: NPC260265

Ingredient ID: NPC248884

Ingredient ID: NPC247976

Ingredient ID: NPC244495

Ingredient ID: NPC234536

Ingredient ID: NPC220998

Ingredient ID: NPC21305

Ingredient ID: NPC212124

Ingredient ID: NPC210058

Ingredient ID: NPC20791

Ingredient ID: NPC189142

Ingredient ID: NPC186100

Ingredient ID: NPC18585

Ingredient ID: NPC185797

Ingredient ID: NPC18074

Ingredient ID: NPC178084

Ingredient ID: NPC173637

Ingredient ID: NPC168799

Ingredient ID: NPC168105

Ingredient ID: NPC166934

Ingredient ID: NPC164980

Ingredient ID: NPC162832

Ingredient ID: NPC159993

Ingredient ID: NPC155198

Ingredient ID: NPC153885

Ingredient ID: NPC152771

Ingredient ID: NPC144499

Ingredient ID: NPC139906

Ingredient ID: NPC13853

Ingredient ID: NPC138472

Ingredient ID: NPC134564

Ingredient ID: NPC12048

Ingredient ID: NPC118935

Ingredient ID: NPC118284

Ingredient ID: NPC117193

Ingredient ID: NPC106985

Ingredient ID: NPC100767

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1B1 Cytochrome P450 1B1 Q16678 CHEMBL4878
Cytochrome P450 Cytochrome P450 family 1 CYP1A1 Cytochrome P450 1A1 P04798 CHEMBL2231
Cytochrome P450 Cytochrome P450 family 1 CYP1A2 Cytochrome P450 1A2 P05177 CHEMBL3356
Cytochrome P450 Cytochrome P450 family 2 CYP2A13 Cytochrome P450 2A13 Q16696 CHEMBL3542436
Therapeutic Target Enzyme POLB DNA polymerase beta P06746 CHEMBL2392
Therapeutic Target Enzyme ALOX12 Arachidonate 12-lipoxygenase P18054 CHEMBL3687
Therapeutic Target Enzyme NOX4 NADPH oxidase 4 Q9NPH5 CHEMBL1250375
Therapeutic Target Hydrolase GAA Lysosomal alpha-glucosidase P10253 CHEMBL2608
Therapeutic Target Lyase CA12 Carbonic anhydrase XII O43570 CHEMBL3242
Therapeutic Target Lyase CA7 Carbonic anhydrase VII P43166 CHEMBL2326
Therapeutic Target Lyase CA4 Carbonic anhydrase IV P22748 CHEMBL3729
Therapeutic Target Metallo protease MMP9 Matrix metalloproteinase 9 P14780 CHEMBL321
Therapeutic Target Metallo protease MMP12 Matrix metalloproteinase 12 P39900 CHEMBL4393
Therapeutic Target Oxidoreductase MAOA Monoamine oxidase A P21397 CHEMBL1951
Therapeutic Target Oxidoreductase HSD17B10 Endoplasmic reticulum-associated amyloid beta-peptide-binding protein Q99714 CHEMBL4159
Therapeutic Target Peptide receptor (family A GPCR) NPSR1 Neuropeptide S receptor Q6W5P4 CHEMBL5162
Therapeutic Target Protein Kinase AXL Tyrosine-protein kinase receptor UFO P30530 CHEMBL4895
Therapeutic Target Protein Kinase YES1 Tyrosine-protein kinase YES P07947 CHEMBL2073
Therapeutic Target Protein Kinase MKNK1 MAP kinase-interacting serine/threonine-protein kinase MNK1 Q9BUB5 CHEMBL4718
Therapeutic Target Protein Kinase IGF1R Insulin-like growth factor I receptor P08069 CHEMBL1957
Therapeutic Target Protein Kinase AURKB Serine/threonine-protein kinase Aurora-B Q96GD4 CHEMBL2185
Therapeutic Target Protein Kinase MKNK2 MAP kinase signal-integrating kinase 2 Q9HBH9 CHEMBL4204
Therapeutic Target Protein Kinase MET Hepatocyte growth factor receptor P08581 CHEMBL3717
Therapeutic Target Protein Kinase FLT3 Tyrosine-protein kinase receptor FLT3 P36888 CHEMBL1974
Therapeutic Target Protein Kinase KDR Vascular endothelial growth factor receptor 2 P35968 CHEMBL279
Therapeutic Target Protein Kinase PIM1 Serine/threonine-protein kinase PIM1 P11309 CHEMBL2147
Therapeutic Target Protein Kinase CDK1 Cyclin-dependent kinase 1 P06493 CHEMBL308
Therapeutic Target Serine protease DPP4 Dipeptidyl peptidase IV P27487 CHEMBL284
Therapeutic Target Transcription factor HIF1A Hypoxia-inducible factor 1 alpha Q16665 CHEMBL4261
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level42
Plant level2
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT00054613 Safety and Efficacy Study of Photopheresis Plus Standard Therapy to Treat Chronic Graft-versus-Host Disease graft versus host disease Methoxsalen (NPC33320) NP level
NCT00004359 Phase II Pilot Study of Extracorporeal Phototherapy for Epidermolysis Bullosa Acquisita epidermolysis bullosa acquisita Methoxsalen (NPC33320) NP level
NCT01686594 PUVA Maintenance Therapy in Mycosis Fungoides mycosis fungoides Methoxsalen (NPC33320) NP level
NCT01348204 Nasal Potential Studies Utilizing Cystic Fibrosis Transmembrane Regulator (CFTR) Modulators cystic fibrosis Quercetin (NPC20791) NP level
NCT02524847 Methoxsalen and Extracorporeal Photopheresis (ECP) for the Treatment of Pediatric Participants With Steroid Refractory Acute Graft Versus Host Disease acute graft vs. host disease Methoxsalen (NPC33320) NP level
NCT00639717 Addition of Etanercept and Extracorporeal Photopheresis (ECP) to Standard Graft-Versus-Host Disease (GVHD) Prophylaxis in Stem Cell Transplant graft versus host disease Methoxsalen (NPC33320) NP level
NCT02848131 Senescence in Chronic Kidney Disease chronic kidney disease Quercetin (NPC20791) NP level
NCT03943459 Sirtuin-1 and Advanced Glycation End-products in Postmenopausal Women With Coronary Disease coronary artery disease Quercetin (NPC20791) NP level
NCT00056056 Ultraviolet Light Therapy Using Methoxsalen With or Without Bexarotene in Treating Patients With Mycosis Fungoides lymphoma Methoxsalen (NPC33320) NP level
NCT05456022 Therapeutic Efficacy of Quercetin Versus Its Encapsulated Nanoparticle on Tongue Squamous Cell Carcinoma Cell Line mouth neoplasm Quercetin (NPC20791) NP level
NCT04851821 The Effectiveness of Phytotherapy in SARS-COV2(COVID-19) COVID-19 Quercetin (NPC20791) NP level
NCT00455416 Dietary Intervention in Follicular Lymphoma follicular lymphoma Quercetin (NPC20791) NP level
NCT04853199 Quercetin In The Treatment Of SARS-COV 2 COVID-19 Quercetin (NPC20791) NP level
NCT01839344 Effects of Quercetin on Blood Sugar and Blood Vessel Function in Type 2 Diabetes. type 2 diabetes mellitus Quercetin (NPC20791) NP level
NCT00056355 Extracorporeal Photopheresis to Maintain Symptoms Remission During Steroid Withdrawal in Patients With Steroid-Dependent Crohn's Disease Crohn's disease Methoxsalen (NPC33320) NP level
NCT05062486 A Study to Evaluate the Safety and Efficacy of RQC for AMD age-related macular degeneration Quercetin (NPC20791) NP level
NCT00930566 Extracorporal Photopheresis Pilot Study lymphoid neoplasm Methoxsalen (NPC33320) NP level
NCT04986605 Extracorporeal Photopheresis in Early Diffuse Cutaneous Systemic Sclerosis diffuse scleroderma Methoxsalen (NPC33320) NP level
NCT03778996 SM-88 Maintenance Therapy for Advanced Ewing's Sarcoma and as Salvage Therapy for Sarcoma Ewing sarcoma Methoxsalen (NPC33320) NP level
NCT00282503 Extracorporeal Photoimmune Therapy With UVADEX for the Treatment of Acute Graft Versus-Host Disease acute graft vs. host disease Methoxsalen (NPC33320) NP level
NCT03908242 Phase I Study of Continuous Administration of Salvianolic Acid A Tablet diabetes mellitus Salvianolic Acid A (NPC38473) NP level
NCT00721643 Absorption Kinetics of Polyphenols in Angel's Plant (Angelica Keiskei) Oxidative Stress Angelica Keiskei Plant level
As plant Extract
NCT05422885 Safety and Feasibility of Dasatinib and Quercetin in Adults at Risk for Alzheimer's Disease aging Quercetin (NPC20791) NP level
NCT00221000 Safety and Efficacy of Extracorporeal Photoimmune Therapy With UVADEX for the Treatment of Rheumatoid Arthritis rheumatoid arthritis Methoxsalen (NPC33320) NP level
NCT03512756 A Randomized Phase 2/3 Multi-Center Study of SM-88 in Patients With Metastatic Pancreatic Cancer pancreatic carcinoma Methoxsalen (NPC33320) NP level
NCT01708278 Beneficial Effects of Quercetin in Chronic Obstructive Pulmonary Disease (COPD) chronic obstructive pulmonary disease Quercetin (NPC20791) NP level
NCT00221026 Safety and Efficacy of Extracorporeal Photoimmune Therapy With UVADEX for the Treatment of Crohn's Disease Crohn's disease Methoxsalen (NPC33320) NP level
NCT04291261 Extracorporal Photopheresis With UVADEX Plus Standard Steroid Treatment for High Risk Acute Graft-versus-host Disease acute graft vs. host disease Methoxsalen (NPC33320) NP level
NCT01720147 Quercetin in Children With Fanconi Anemia; a Pilot Study Fanconi anemia Quercetin (NPC20791) NP level
NCT02226484 Can Quercetin Increase Claudin-4 and Improve Esophageal Barrier Function in GERD? gastroesophageal reflux disease Quercetin (NPC20791) NP level
NCT01912820 Effect of Quercetin on Green Tea Polyphenol Uptake in Prostate Tissue From Patients With Prostate Cancer Undergoing Surgery prostate adenocarcinoma Quercetin (NPC20791) NP level
NCT01438320 Q-Trial in Patients With Hepatitis C chronic hepatitis C virus infection Quercetin (NPC20791) NP level
NCT05276895 Effect of Natural Senolytic Agents & NLRP3 Inhibitors on Osteoarthritis osteoarthritis Quercetin (NPC20791) NP level
NCT03989271 Biological Effects of Quercetin in COPD chronic obstructive pulmonary disease Quercetin (NPC20791) NP level
NCT00533195 Comparison of UVA1 Phototherapy Versus Photochemotherapy for Patients With Severe Generalized Atopic Dermatitis atopic eczema Bergapten (NPC74539) NP level
NCT00963118 Bioactive Plant Foods: Effects on Functional Bioavailability and Genomic Stability Metabolic Syndrome Angelica Keiskei Plant level
As recipes of formula
NCT03563040 Study of Photopheresis in the Treatment of Erythrodermic MF and SS Sezary's disease;mycosis fungoides Methoxsalen (NPC33320) NP level
NCT03791125 Phase I Single-dose Escalation Clinical Trial of Salvianolic Acid A Tablets diabetic neuropathy Salvianolic Acid A (NPC38473) NP level
NCT04946383 Safety and Effectivness of Quercetin & Dasatinib on Epigenetic Aging aging Quercetin (NPC20791) NP level
NCT00030589 Chemotherapy and Photodynamic Therapy in Treating Patients With Cutaneous T-Cell Lymphoma lymphoma Methoxsalen (NPC33320) NP level
NCT00054600 Safety and Efficacy Study of Photopheresis With UVADEX to Prevent Graft-versus-Host Disease graft versus host disease Methoxsalen (NPC33320) NP level
NCT04907253 Quercetin in Coronary Artery By-pass Surgery coronary artery disease Quercetin (NPC20791) NP level
NCT04733534 An Open-Label Intervention Trial to Reduce Senescence and Improve Frailty in Adult Survivors of Childhood Cancer childhood cancer Quercetin (NPC20791) NP level
NCT01375101 Therapeutic Effect of Quercetin and the Current Treatment of Erosive and Atrophic Oral Lichen Planus oral lichen planus Quercetin (NPC20791) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 AURKB,NOX4,MMP12,MET,NPSR1,CDK1,CYP19A1,ALOX15,MMP9
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 AURKB,CA7,CA12,ALOX12,MMP12,NPSR1,CDK1,MMP9,XDH
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CA7,CYP1B1,NOX4,CA12,MMP12,MET,ALOX5,DPP4,XDH
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 ACHE,CA7,AURKB,CA12,MMP12,NPSR1,CDK1,MMP9,XDH
Colorectal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B91
 TP53,MKNK1,IGF1R,MET,KDR,EGFR,MKNK2,FLT3
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 AURKB,ACHE,NOX4,MMP12,NPSR1,CDK1,ALOX15,MMP9
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 AURKB,MMP12,NPSR1,CYP1A1,CDK1,ALOX15,MMP9,XDH
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CSNK2A3,GAA,CYP1B1,CA12,KDR,MET,DPP4,CYP19A1
Brain cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00
 MMP9,SRC,EGFR,KDR,HIF1A,MET,TP53
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 AURKB,PIM1,GSK3B,TP53,SRC,AXL,FLT3
Liver cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12
 CSNK2A1,MKNK2,MET,MKNK1,KDR,IGF1R,EGFR
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 ACHE,CA4,NOX4,MMP12,MET,MMP9,XDH
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 CYP2A6,AURKB,CA12,MMP12,CDK1,MMP9,CYP2A13
Mature T-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A90
 HIF1A,MKNK1,MKNK2,EGFR
 NCT00056056,NCT00030589
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 SRC,TP53,CDK1,FLT3,DPP4,AURKB
Graft-versus-host disease
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4B24
 NCT02524847,NCT00282503,NCT00054600,NCT00054613,NCT00639717,NCT04291261
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 NOX4,MMP12,FLT3,DPP4,MMP9,AKR1B1
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 AURKB,CA12,MMP12,CDK1,MMP9,XDH
Stomach cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 TP53,KDR,MET,EGFR,MMP9
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 ALOX5,DPP4,CYP2A6,FLT3
 MMP12
Multiple myeloma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A83
 AXL,IGF1R,FLT3,KDR,SRC
Renal cell carcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90
 MMP12,EGFR,MET,KDR,MMP9
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 FLT3,ACHE,MET,MAOA,KDR
Ovarian cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73
 MET,SRC,KDR,FLT3,TP53
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 ALOX5,AKR1B1,ABCG2,MMP9
 NCT00221000
Crohn disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD70
 MMP9
 MMP9,MMP12
 NCT00221026,NCT00056355
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 AURKB,NOX4,MMP12,NPSR1,MMP9
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 ACHE,AXL,MET,DPP4,CYP19A1
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 NOX4,MMP12,MET,NPSR1,CYP1A1
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 AURKB,CYP1A2,CDK1,MMP9,AKR1B1
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 EGFR,AXL,HIF1A,CYP19A1,XDH
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 AURKB,CA12,CYP1A2,MET,CYP1A1
NA
Disease Category: NA
Disease ICD-11 Code: NA
 MET,NOX4
 NCT00721643
 NCT04986605
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 ACHE,IGF1R,ALOX5,AKR1B1
Mature B-cell leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A82
 EGFR,AXL,SRC,TP53
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 MET,ACHE,CA4,AKR1B1
Head and neck cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D42
 MET,TP53,EGFR,KDR
Peritoneal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C51
 KDR,FLT3,TP53,SRC
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 AURKB,AKR1B1,DPP4,KDR
Parkinsonism
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00
 MAOA,ACHE,SRC,GSK3B
Myelodysplastic syndrome
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A37
 TP53,KDR,AXL,EGFR
Pancreatic cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 EGFR,TP53,SRC,IGF1R
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 DPP4,CA4,ACHE,SRC
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 ACHE,CYP1A1,ALOX15,MMP9
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 ACHE,YES1,CYP1A1,MMP9
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 GAA,CYP1B1,NOX4,DPP4
Chronic pain
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG30
 EGFR,FLT3,KDR
Melanoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 MET,KDR,EGFR
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 SRC,MET,KDR
Myeloproliferative neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A20
 FLT3,GSK3B,SRC
Chronic arterial occlusive disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 DPP4,TP53,MET
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 ALOX5,CA4,MMP12
Metastatic lymph node neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60
 EGFR,KDR,MET
Pleomorphic sarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B54
 KDR,SRC,MET
Non-small cell lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 EGFR,KDR,MET
Chronic kidney disease
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB61
 IGF1R,XDH
 NCT02848131
Nasopharyngeal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6B
 ALOX5,EGFR,CDK1
Mycosis fungoides
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B01
 CYP2A6
 NCT03563040,NCT01686594
Adenocarcinoma of prostate
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82.0
 NOX4,ALOX15
 NCT01912820
Inflammatory bowel diseases, unspecified
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD7Z
 MMP9,NOX4,MMP12
Osteoarthritis, unspecified
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA0Z
 CA12,CDK1,MMP9
Dengue fever, unspecified
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D2Z
 MAOA,ABCG2,AURKB
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 NOX4,IGF1R,ABCG2
Pneumonia due to Pseudomonasaeruginosa
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA40.05
 MMP9,DPP4,MMP12
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 MMP9,CYP1A1,MMP12
Human immunodeficiency virus disease without mention of tuberculosis or malaria
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C62
 AXL,FLT3,MET
Ebola virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D60.01
 AXL,MET,ACHE
Gliomas of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.0
 NOX4,MMP12,MMP9
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 KDR,CA4,POLB,MET,TP53,CSNK2A1,MKNK2,GSK3B,EGFR,AURKB,ALOX5,CDK1,SRC,MKNK1,XDH,IGF1R,HIF1A,MMP9,FLT3,AXL,YES1,PIM1,CA12
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 CA7,MMP12,SRC,DPP4,XDH,RECQL,EGFR,AURKB,CSNK2A2,CDK1,MMP9,MET,FLT3,ALOX15,PIM1,GAA,CA12,AXL,ALOX5,KDR
Metabolic disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5D2Z
 DPP4
 NCT00963118
Fallopian tube cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C74
 TP53,SRC
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 MAOA,AURKB
Gastrointestinal stromal tumour
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B5B
 KDR,SRC
Substance abuse
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C40
 MAOA,ACHE
Thrombocytopenia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64
 KDR,ALOX5
Unspecific body region injury
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: ND56
 EGFR,MET
Idiopathic interstitial pneumonitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB03
 FLT3,ALOX5
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA12,CA4
Postoperative inflammation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-CA43
 SRC,ALOX5
Malignant digestive organ neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C11
 KDR,SRC
Pituitary gland disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A60-5A61
 ALOX5,IGF1R
Ischemia
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B10-8B11
 EGFR,SRC
Osteosarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B51
 GSK3B,SRC
Atopic eczema
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA80
 ALOX5
 NCT00533195
Motor neuron disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B60
 IGF1R,SRC
BCR-ABL1-negative chronic myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A41
 FLT3,SRC
Influenza
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E30-1E32
 XDH,ALOX5
Mature B-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A85
 CDK1,FLT3
Thyroid cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10
 KDR,MET
Endometrial cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76
 TP53,SRC
Diabetes mellitus, type unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A14
 DPP4
 NCT03908242
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA4,CA12
Cervical cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C77
 TP53,SRC
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 DPP4
 NCT01839344
Neuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C0Z
 AKR1B1,CYP19A1
Ageing associated decline in intrinsic capacity
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG2A
 NCT04946383,NCT05422885
COVID-19
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D6Y
 NCT04853199,NCT04851821
coronary artery disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA8Y-BA8Z
 NCT04907253,NCT03943459
Chronic obstructive pulmonary disease
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA22
 NCT03989271,NCT01708278
Coeliac disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA95
 CYP1A1,CDK1
Zika virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D48
 AXL,ACHE
Idiopathic pulmonary fibrosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB03.4
 CYP2A13,MMP12
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 CA4,ABCG2
Heart failure, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD1Z
 CYP1B1,ABCG2
Lyme borreliosis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C1G
 MMP9,MET
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 CA7,MMP12,DPP4,POLB,TP53,XDH,AURKB,HSD17B10,MMP9,MET,YES1,CYP19A1,ALOX15,NPSR1,CYP2A13,AKR1B1
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 ACHE,CA7,AURKB,CYP1B1,AXL,MET,NPSR1,ALOX5,DPP4,POLB,HIF1A,ALOX15,XDH,PIM1,ABCG2,RECQL
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 ALOX12,MMP12,TP53,XDH,MMP9,NOX4,MET,YES1,ALOX15,CSNK2A3,GAA,CA12,CYP1A2,ALOX5,CYP2A13
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 ACHE,SRC,TP53,RECQL,EGFR,AURKB,HSD17B10,CSNK2A2,CDK1,NOX4,MET,CA12,AXL,KDR,AKR1B1
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 AURKB,CA4,CA12,NOX4,MMP12,CDK1,CYP19A1,MMP9,AURKB,CA12,MMP12,SRC,CDK1,CYP19A1,MMP9
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 CA4,ACHE,CA12,NOX4,ALOX12,KDR,MET,NPSR1,ALOX5,DPP4,HIF1A,CDK1,XDH,ABCG2,AKR1B1
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 ALOX12,MMP12,SRC,TP53,CA4,AURKB,HIF1A,CDK1,MMP9,NOX4,CSNK2A3,ALOX5,IGF1R,AKR1B1
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 CDK1,SRC,MET,AXL,CA12,CA4,IGF1R,MKNK1,MKNK2,KDR,EGFR,CYP19A1
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 CA4,AURKB,CA12,NOX4,MMP12,SRC,IGF1R,CDK1,CYP19A1,MMP9,AKR1B1
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 AURKB,ACHE,MET,ALOX5,CYP19A1,MMP9,XDH,AURKB,MMP12,ALOX5,MMP9
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 AURKB,CA4,CA7,NOX4,CA12,MMP12,MET,DPP4,CDK1,CYP19A1,MMP9
Lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 MMP12,CDK1,MMP9,EGFR,IGF1R,KDR,ALOX5,MET,AXL,FLT3
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 ACHE,GAA,CYP1B1,MMP12,FLT3,HSD17B10,DPP4,ALOX15,MMP9,AKR1B1
Malignant mesenchymal neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B5D-2B5Y
 EGFR
Mineral deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B5K
 XDH
Esophageal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 TP53
Coronavirus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D92
 CSNK2A1
Autism spectrum disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A02
 DPP4
Metastatic digestive system neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D8Y
 SRC
Pulmonary hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BB01
 HIF1A
General pain disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E43
 MAOA
Myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41-BA43
 DPP4
Carcinoid syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B10
 ALOX5
Chronic myelomonocytic leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A40
 FLT3
Metastatic liver/bile duct neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D80
 TP53
Epidermal dysplasias
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EK90
 SRC
Heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10-BD1Z
 XDH
Leiomyosarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B58
 SRC
Hepatitis virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E50-1E51
 EGFR
Colon cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90
 EGFR
Encephalopathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E47
 XDH
Skin tag/polyp
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EK71
 MAOA
Multiple sclerosis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A40
 SRC
Intracerebral haemorrhage
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B00
 EGFR
Schizophrenia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20
 AKR1B1
Fragile X chromosome
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD55
 GSK3B
Unspecific substance harmful effect
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE6Z
 ACHE
Transplant rejection
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE84
 TP53
Myotonic disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71
 GSK3B
Ovarian dysfunction
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80
 TP53
Cataract
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B10
 AKR1B1
Myasthenia gravis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C6Y
 ACHE
Synovial sarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B5A
 SRC
Dementia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D80-6D8Z
 ACHE
Angina pectoris
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40
 EGFR
Endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10
 CYP19A1
Bladder cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94
 TP53
Lip/oral cavity/pharynx neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6E
 TP53
Acquired hypomelanotic disorder
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED63
 MAOA
Oesophagitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA24
 CYP19A1
Multiple structural anomalies syndrome
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD2F
 IGF1R
Mild neurocognitive disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D71
 ACHE
Hypopharyngeal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6D
 EGFR
Mastocytosis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A21
 FLT3
Mood disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A60-6E23
 MAOA
Parasitic worm infestation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F90
 ACHE
Irritable bowel syndrome
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD91
 ABCG2
Urethral cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C93
 EGFR
Pediculosis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G00
 ACHE
Inflammatory arthropathy
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA2Z
 FLT3
Cushing syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A70
 CYP19A1
Spinal cord/cranial nerve neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A02
 EGFR
Filariasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F66
 ALOX5
Gout
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA25
 XDH
Ischaemic/haemorrhagic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B20
 MMP9
Extraocular muscle disorder
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C82
 IGF1R
Skin postprocedural disorder
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EL8Y
 EGFR
Liposarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B59
 TP53
Ischemic heart disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40-BA6Z
 MET
Phakomatoses/hamartoneoplastic syndrome
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD2D
 FLT3
Kidney failure
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB60-GB6Z
 TP53
Bone/articular cartilage neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2F7B
 FLT3
Thyrotoxicosis
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A02
 IGF1R
Biliary tract cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C17
 MET
Metastatic malignant neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D50-2E09
 AXL
Liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB90-DB9Z
 MET
Transplanted organ/tissue
Disease Category: 24.Factors influencing health status or contact with health services
Disease ICD-11 Code: QB63
 FLT3
Digestive organ benign neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2E92
 KDR
Retinopathy
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B71
 IGF1R
Fungal infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F29-1F2F
 ALOX5
Metastatic biliary tract neoplasms
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C14-2C17
 EGFR
Adrenomedullary hyperfunction
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A75
 HIF1A
Thrombosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB61-GB90
 AKR1B1
Ulcerative colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD71
 MMP9
Diffuse large B-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 FLT3
Oesophageal/gastroduodenal disorder
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD90
 ACHE
Inborn purine/pyrimidine/nucleotide metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C55
 XDH
Depression
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A70-6A7Z
 MAOA
Inborn carbohydrate metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C51
 GAA
Unspecified viral infection of unspecified site
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D9Z
 FLT3
Testicular cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80
 EGFR
Diabetic foot ulcer
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD54
 EGFR
Human immunodeficiency virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C60-1C62
 FLT3
Ewing sarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B52
 NCT03778996
Sezary syndrome
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH8HN3
 NCT03563040
Epidermolysis bullosa acquisita
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EB43
 NCT00004359
Unspecified malignant neoplasms of unspecified sites
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D4Z
 NCT04733534
Neoplasms of haematopoietic or lymphoid tissues, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B3Z
 NCT00930566
Congenital aplastic anaemia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3A70.0
 NCT01720147
Gastro-oesophageal reflux disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA22
 NCT02226484
Malignant neoplasm of pancreas, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.Z
 NCT03512756
Lichen planus
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA91
 NCT01375101
Malignant neoplasms of other or unspecified parts of mouth
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B66
 NCT05456022
Follicular lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A80
 NCT00455416
Osteoarthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA00-FA05
 NCT05276895
Diabetic polyneuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C03.0
 NCT03791125
Macular degeneration
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B75
 NCT05062486
Chronic hepatitis C
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E51.1
 NCT01438320
Cystic fibrosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA25
 NCT01348204
Myelodysplastic syndromes, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A3Z
 PIM1
Atrial fibrillation
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC81.3
 CA7
Non-alcoholic fatty liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB92
 MMP9
Myotonic dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71.0
 CYP1A1
Keratoconus
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9A78.50
 CA4
Pre-eclampsia
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA24
 CA4
Systemic sclerosis
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A42
 NOX4
Polycystic ovary syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80.1
 MMP12
Dilated cardiomyopathy
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC43.0
 ABCG2
Malaria, unspecified
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F4Z
 MMP9

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group