• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Geum Urbanum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAACCTGCCCAGCAGAACCACAAGAGAACATGTTCAATGCTCGGGGAGGAGGGGCATGTTCCCTCTTCCCCGCTTCTTGGGGGGTACCGCTGTGTATGCAGTGGAACCTTCTGAGCGTAAAACGAACACCGGCGTGTATTGCGCCAAGGAACTTGAATGAAAGAGCGTTCCCTCGACGTCCTGGAAACAGTGTGCGCTCGAGTGGTTTCGTCATCTTCAATATGTCTAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO20988
Plant Latin Name: Geum Urbanum
Taxonomy Genus: Geum
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 57919
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

11 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


11 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

3 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97338

Ingredient ID: NPC87555

Ingredient ID: NPC75865

Ingredient ID: NPC68566

Ingredient ID: NPC44555

Ingredient ID: NPC37206

Ingredient ID: NPC33638

Ingredient ID: NPC310332

Ingredient ID: NPC280254

Ingredient ID: NPC222342

Ingredient ID: NPC19426