• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Patrinia Scabiosifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCACAGCAGAACGACCCGCGAACATGTTCGTACACGGGGACGCCGGCCGCGAGGCCGGTGCTCCCATGGTAGCGGTGCCTTCCGGCTCCGCGACCGCAAACCGAACCCCGGCGCGATCCGCGCCAAGGAACAAGAAATCAGGAGGCGAGCGCCAACCCAGCCGGCCCGTTTGCGGCGCGGGCTGGGCGAACGCGGCCCACCGGAAGAAACACAAACGACTCTCGGCAACCGGAATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCAAACCCGCTTCCAAAGAAGTCGGCGCAGCGGGGGGAGCGGACAATGGCCTGCCGGGTCCCCGGGCTCGGCTGGCCTAAAATCGAGTCCCCGGCGGCGGACGTCACGACGAGTGGTGGTCGAAACAGCGCTCTTATCGCGTCGTGCGTTTCCCCGTCGATCGGGCGACCAAGTGACCCTGACGCGTCGTCTTCGACGGCGCTCCGA

Click for details-----ITS1

TCGAAACCTGCACAGCAGAACGACCCGCGAACATGTTCGTACACGGGGACGCCGGCCGCGAGGCCGGTGCTCCCATGGTAGCGGTGCCTTCCGGCTCCGCGACCGCAAACCGAACCCCGGCGCGATCCGCGCCAAGGAACAAGAAATCAGGAGGCGAGCGCCAACCCAGCCGGCCCGTTTGCGGCGCGGGCTGGGCGAACGCGGCCCACCGGAAGAAACACAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCCAAACCCGCTTCCAAAGAAGTCGGCGCAGCGGGGGGAGCGGACAATGGCCTGCCGGGTCCCCGGGCTCGGCTGGCCTAAAATCGAGTCCCCGGCGGCGGACGTCACGACGAGTGGTGGTCGAAACAGCGCTCTTATCGCGTCGTGCGTTTCCCCGTCGATCGGGCGACCAAGTGACCCTGACGCGTCGTCTTCGACGGCGCTCCGA
Taxonomic Information

Plant ID: NPO20930
Plant Latin Name: Patrinia Scabiosifolia
Taxonomy Genus: Patrinia
Taxonomy Family: Caprifoliaceae

Plant External Links:

NCBI TaxonomyDB: 300888
Plant-of-the-World-Online: 859466-1

Used in Medicines

Unknown.

Geographical Distribution

South Africa

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

116 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


68 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

52 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98925

Ingredient ID: NPC98661

Ingredient ID: NPC95054

Ingredient ID: NPC85185

Ingredient ID: NPC8466

Ingredient ID: NPC84319

Ingredient ID: NPC83108

Ingredient ID: NPC76972

Ingredient ID: NPC76336

Ingredient ID: NPC73863

Ingredient ID: NPC71074

Ingredient ID: NPC70909

Ingredient ID: NPC67920

Ingredient ID: NPC6520

Ingredient ID: NPC61248

Ingredient ID: NPC53545

Ingredient ID: NPC52403

Ingredient ID: NPC51700

Ingredient ID: NPC50898

Ingredient ID: NPC50340

Ingredient ID: NPC49151

Ingredient ID: NPC42471

Ingredient ID: NPC424

Ingredient ID: NPC3868

Ingredient ID: NPC36744

Ingredient ID: NPC34589

Ingredient ID: NPC33761

Ingredient ID: NPC33489

Ingredient ID: NPC32279

Ingredient ID: NPC31349

Ingredient ID: NPC306478

Ingredient ID: NPC306202

Ingredient ID: NPC305693

Ingredient ID: NPC304309

Ingredient ID: NPC301696

Ingredient ID: NPC301585

Ingredient ID: NPC296014

Ingredient ID: NPC292293

Ingredient ID: NPC291129

Ingredient ID: NPC291024

Ingredient ID: NPC290957

Ingredient ID: NPC290613

Ingredient ID: NPC290563

Ingredient ID: NPC29

Ingredient ID: NPC289774

Ingredient ID: NPC288537

Ingredient ID: NPC287967

Ingredient ID: NPC287397

Ingredient ID: NPC283790

Ingredient ID: NPC28198

Ingredient ID: NPC279554

Ingredient ID: NPC279121

Ingredient ID: NPC276332

Ingredient ID: NPC26974

Ingredient ID: NPC26960

Ingredient ID: NPC2665

Ingredient ID: NPC265197

Ingredient ID: NPC264949

Ingredient ID: NPC264711

Ingredient ID: NPC262505

Ingredient ID: NPC26229

Ingredient ID: NPC261831

Ingredient ID: NPC253702

Ingredient ID: NPC253587

Ingredient ID: NPC250420

Ingredient ID: NPC24986

Ingredient ID: NPC246173

Ingredient ID: NPC245735

Ingredient ID: NPC241721

Ingredient ID: NPC237837

Ingredient ID: NPC233533

Ingredient ID: NPC230336

Ingredient ID: NPC230301

Ingredient ID: NPC225836

Ingredient ID: NPC220089

Ingredient ID: NPC219146

Ingredient ID: NPC216630

Ingredient ID: NPC215324

Ingredient ID: NPC214710

Ingredient ID: NPC214030

Ingredient ID: NPC209970

Ingredient ID: NPC208936

Ingredient ID: NPC20791

Ingredient ID: NPC20742

Ingredient ID: NPC202418

Ingredient ID: NPC201844

Ingredient ID: NPC197763

Ingredient ID: NPC196776

Ingredient ID: NPC195000

Ingredient ID: NPC192977

Ingredient ID: NPC192227

Ingredient ID: NPC187892

Ingredient ID: NPC184824

Ingredient ID: NPC184572

Ingredient ID: NPC182102

Ingredient ID: NPC179831

Ingredient ID: NPC1788

Ingredient ID: NPC171495

Ingredient ID: NPC163556

Ingredient ID: NPC162310

Ingredient ID: NPC156654

Ingredient ID: NPC155183

Ingredient ID: NPC153958

Ingredient ID: NPC153552

Ingredient ID: NPC149203

Ingredient ID: NPC142753

Ingredient ID: NPC136877

Ingredient ID: NPC135020

Ingredient ID: NPC133671

Ingredient ID: NPC132558

Ingredient ID: NPC125851

Ingredient ID: NPC121664

Ingredient ID: NPC115891

Ingredient ID: NPC113928

Ingredient ID: NPC112866

Ingredient ID: NPC104272