• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Atractylodes Macrocephala


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAGCCTGCACAGCAGAACGACCCGCGAACATGTAACGACAACCGGGCATCGGGGGGAACGGGCGCAAGCCCGGGACCTGCGGCGCTCCGTCGGCGAGCGTCCGTGGCGCACCTATCGGGGCCTCGCGGGCGTTTCGTCGGCACGTAAACAAACCCCGGCACAACACGTGCCAAGGAAAACAAAACTTAAGAAGGGCGCTTCTCGTGTCGCCCCGTTCGCGGTGCGCGCATGGGTCGTGGCCTCTCTGGAAACACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCGACCACGCCTCCCCCACGGGGACGCGTGTCGTCAGGGGCGGAGATTGGTCTCCCGTGCCCACGGCGCGGCTGGCCTAAACAGGAGTCCCCTTCGACGGACGCACGGCTAGTGGTGGTTGTAATGGCCCTCGTATTGAGCCGTGCGTCGCGAGCCGCAAGGGAAGCGCTCGACAAAGACCCCAACGCGTCGCCTCGCGACGACGCTTCGA

Click for details-----ITS1

TCGAAGCCTGCACAGCAGAACGACCCGCGAACATGTAACGACAACCGGGCATCGGGGGGAACGGGCGCAAGCCCGGGACCTGCGGCGCTCCGTCGGCGAGCGTCCGTGGCGCACCTATCGGGGCCTCGCGGGCGTTTCGTCGGCACGTAAACAAACCCCGGCACAACACGTGCCAAGGAAAACAAAACTTAAGAAGGGCGCTTCTCGTGTCGCCCCGTTCGCGGTGCGCGCATGGGTCGTGGCCTCTCTGGAAACACAAA

Click for details-----ITS2

ATCGCGTCGCCCCCGACCACGCCTCCCCCACGGGGACGCGTGTCGTCAGGGGCGGAGATTGGTCTCCCGTGCCCACGGCGCGGCTGGCCTAAACAGGAGTCCCCTTCGACGGACGCACGGCTAGTGGTGGTTGTAATGGCCCTCGTATTGAGCCGTGCGTCGCGAGCCGCAAGGGAAGCGCTCGACAAAGACCCCAACGCGTCGCCTCGCGACGACGCTTCGA
Taxonomic Information

Plant ID: NPO20902
Plant Latin Name: Atractylodes Macrocephala
Taxonomy Genus: Atractylodes
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 265785
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Antibacterial; Diuretic; Sedative; Stomachic; Tonic

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

243 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


201 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

90 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99480

Ingredient ID: NPC92592

Ingredient ID: NPC90803

Ingredient ID: NPC90704

Ingredient ID: NPC90506

Ingredient ID: NPC89886

Ingredient ID: NPC85813

Ingredient ID: NPC85248

Ingredient ID: NPC82648

Ingredient ID: NPC76817

Ingredient ID: NPC76145

Ingredient ID: NPC7568

Ingredient ID: NPC75204

Ingredient ID: NPC75048

Ingredient ID: NPC7491

Ingredient ID: NPC7097

Ingredient ID: NPC70698

Ingredient ID: NPC67920

Ingredient ID: NPC6697

Ingredient ID: NPC66577

Ingredient ID: NPC66303

Ingredient ID: NPC65861

Ingredient ID: NPC637

Ingredient ID: NPC60911

Ingredient ID: NPC59581

Ingredient ID: NPC58970

Ingredient ID: NPC55987

Ingredient ID: NPC54996

Ingredient ID: NPC54368

Ingredient ID: NPC53975

Ingredient ID: NPC53966

Ingredient ID: NPC53720

Ingredient ID: NPC52230

Ingredient ID: NPC49151

Ingredient ID: NPC47795

Ingredient ID: NPC45727

Ingredient ID: NPC45270

Ingredient ID: NPC42886

Ingredient ID: NPC424

Ingredient ID: NPC41385

Ingredient ID: NPC41296

Ingredient ID: NPC40521

Ingredient ID: NPC37871

Ingredient ID: NPC3693

Ingredient ID: NPC36408

Ingredient ID: NPC36108

Ingredient ID: NPC34764

Ingredient ID: NPC34589

Ingredient ID: NPC33407

Ingredient ID: NPC328589

Ingredient ID: NPC328172

Ingredient ID: NPC328058

Ingredient ID: NPC326143

Ingredient ID: NPC324153

Ingredient ID: NPC322540

Ingredient ID: NPC322415

Ingredient ID: NPC321027

Ingredient ID: NPC320738

Ingredient ID: NPC320649

Ingredient ID: NPC320227

Ingredient ID: NPC319002

Ingredient ID: NPC318203

Ingredient ID: NPC317009

Ingredient ID: NPC313107

Ingredient ID: NPC311753

Ingredient ID: NPC310820

Ingredient ID: NPC310758

Ingredient ID: NPC310478

Ingredient ID: NPC309317

Ingredient ID: NPC304638

Ingredient ID: NPC301964

Ingredient ID: NPC300238

Ingredient ID: NPC296084

Ingredient ID: NPC294857

Ingredient ID: NPC294136

Ingredient ID: NPC291066

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC288932

Ingredient ID: NPC287731

Ingredient ID: NPC287397

Ingredient ID: NPC287335

Ingredient ID: NPC286904

Ingredient ID: NPC284927

Ingredient ID: NPC284806

Ingredient ID: NPC28402

Ingredient ID: NPC280965

Ingredient ID: NPC279300

Ingredient ID: NPC279201

Ingredient ID: NPC279121

Ingredient ID: NPC2785

Ingredient ID: NPC277736

Ingredient ID: NPC277704

Ingredient ID: NPC275669

Ingredient ID: NPC273385

Ingredient ID: NPC271171

Ingredient ID: NPC271118

Ingredient ID: NPC271087

Ingredient ID: NPC270266

Ingredient ID: NPC267779

Ingredient ID: NPC267056

Ingredient ID: NPC265705

Ingredient ID: NPC265258

Ingredient ID: NPC264779

Ingredient ID: NPC263103

Ingredient ID: NPC261831

Ingredient ID: NPC260089

Ingredient ID: NPC259364

Ingredient ID: NPC254159

Ingredient ID: NPC253963

Ingredient ID: NPC253727

Ingredient ID: NPC252257

Ingredient ID: NPC249815

Ingredient ID: NPC24967

Ingredient ID: NPC249174

Ingredient ID: NPC249009

Ingredient ID: NPC247553

Ingredient ID: NPC246543

Ingredient ID: NPC245927

Ingredient ID: NPC245896

Ingredient ID: NPC245789

Ingredient ID: NPC245187

Ingredient ID: NPC24294

Ingredient ID: NPC239406

Ingredient ID: NPC239375

Ingredient ID: NPC237962

Ingredient ID: NPC235279

Ingredient ID: NPC235260

Ingredient ID: NPC234231

Ingredient ID: NPC233376

Ingredient ID: NPC232375

Ingredient ID: NPC231738

Ingredient ID: NPC23145

Ingredient ID: NPC231331

Ingredient ID: NPC230329

Ingredient ID: NPC230301

Ingredient ID: NPC227670

Ingredient ID: NPC227514

Ingredient ID: NPC225710

Ingredient ID: NPC225657

Ingredient ID: NPC222628

Ingredient ID: NPC222181

Ingredient ID: NPC222109

Ingredient ID: NPC219969

Ingredient ID: NPC217226

Ingredient ID: NPC216900

Ingredient ID: NPC216630

Ingredient ID: NPC215412

Ingredient ID: NPC212487

Ingredient ID: NPC209275

Ingredient ID: NPC208936

Ingredient ID: NPC208764

Ingredient ID: NPC208361

Ingredient ID: NPC207844

Ingredient ID: NPC204596

Ingredient ID: NPC204396

Ingredient ID: NPC200745

Ingredient ID: NPC19835

Ingredient ID: NPC197783

Ingredient ID: NPC197392

Ingredient ID: NPC19685

Ingredient ID: NPC196711

Ingredient ID: NPC195717

Ingredient ID: NPC194040

Ingredient ID: NPC193180

Ingredient ID: NPC190810

Ingredient ID: NPC190693

Ingredient ID: NPC190301

Ingredient ID: NPC189853

Ingredient ID: NPC189206

Ingredient ID: NPC188558

Ingredient ID: NPC187892

Ingredient ID: NPC184831

Ingredient ID: NPC184679

Ingredient ID: NPC184049

Ingredient ID: NPC183422

Ingredient ID: NPC179950

Ingredient ID: NPC179303

Ingredient ID: NPC178382

Ingredient ID: NPC178134

Ingredient ID: NPC177372

Ingredient ID: NPC176985

Ingredient ID: NPC176819

Ingredient ID: NPC176309

Ingredient ID: NPC175999

Ingredient ID: NPC173421

Ingredient ID: NPC170747

Ingredient ID: NPC168579

Ingredient ID: NPC167805

Ingredient ID: NPC166362

Ingredient ID: NPC163984

Ingredient ID: NPC16157

Ingredient ID: NPC158574

Ingredient ID: NPC154477

Ingredient ID: NPC151273

Ingredient ID: NPC150837

Ingredient ID: NPC150643

Ingredient ID: NPC150554

Ingredient ID: NPC149932

Ingredient ID: NPC146197

Ingredient ID: NPC144682

Ingredient ID: NPC143639

Ingredient ID: NPC141777

Ingredient ID: NPC139795

Ingredient ID: NPC138347

Ingredient ID: NPC137949

Ingredient ID: NPC13789

Ingredient ID: NPC137153

Ingredient ID: NPC135718

Ingredient ID: NPC135648

Ingredient ID: NPC135388

Ingredient ID: NPC133792

Ingredient ID: NPC133671

Ingredient ID: NPC131311

Ingredient ID: NPC12987

Ingredient ID: NPC129588

Ingredient ID: NPC128634

Ingredient ID: NPC126029

Ingredient ID: NPC124294

Ingredient ID: NPC12269

Ingredient ID: NPC121617

Ingredient ID: NPC121322

Ingredient ID: NPC119267

Ingredient ID: NPC11666

Ingredient ID: NPC114011

Ingredient ID: NPC113837

Ingredient ID: NPC113733

Ingredient ID: NPC113670

Ingredient ID: NPC113307

Ingredient ID: NPC109907

Ingredient ID: NPC109813

Ingredient ID: NPC108218

Ingredient ID: NPC107015

Ingredient ID: NPC106507

Ingredient ID: NPC10636

Ingredient ID: NPC106250

Ingredient ID: NPC105557

Ingredient ID: NPC105544

Ingredient ID: NPC105509

Ingredient ID: NPC102495

Ingredient ID: NPC102091

Ingredient ID: NPC101285

Ingredient ID: NPC100980