• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Clerodendrum Bungei


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGAACAGCAAACCGCGAACACGTGTTTAAACAAATTGGGCTACGGTCCCTTTCTCGCCGGCGTGCGCCACCACGTCACCGTGCGGGCTAACAAAATCGGGCGCGGAATGCGCCAAGGAATACATAAAAGAGTGTTCCCCTCCACATGGCCCGTACGCGGAGATTGTGGTGGAAGGTTGGGATGCCTATCATATAAAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTTTCCTGGGCGTCACGCATCGCGTCACCTCCCTCCGTGCACAATGCTATTGGATGGAGGGTGGATATTGGCCTCCCGTGCGTCATTCCCGTGCGGCTGGTCCAAATTTGATCCATCGGCGACAAATCTCACGACCAGGGGTTGGTTGAAGTATCAACTCGCGTGCTGTTGTGCCACAAAATGTCTTTCCGATTTGGAGTCAATACAGACCCAACGGCGCATGCATGCATCGCGTCTCCGAC

Click for details-----ITS1

TCGAAACCTGAACAGCAAACCGCGAACACGTGTTTAAACAAATTGGGCTACGGTCCCTTTCTCGCCGGCGTGCGCCACCACGTCACCGTGCGGGCTAACAAAATCGGGCGCGGAATGCGCCAAGGAATACATAAAAGAGTGTTCCCCTCCACATGGCCCGTACGCGGAGATTGTGGTGGAAGGTTGGGATGCCTATCATATAAAAAA

Click for details-----ITS2

ATCGCGTCACCTCCCTCCGTGCACAATGCTATTGGATGGAGGGTGGATATTGGCCTCCCGTGCGTCATTCCCGTGCGGCTGGTCCAAATTTGATCCATCGGCGACAAATCTCACGACCAGGGGTTGGTTGAAGTATCAACTCGCGTGCTGTTGTGCCACAAAATGTCTTTCCGATTTGGAGTCAATACAGACCCAACGGCGCATGCATGCATCGCGTCTCCGAC
Taxonomic Information

Plant ID: NPO20879
Plant Latin Name: Clerodendrum Bungei
Taxonomy Genus: Clerodendrum
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 54211
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Anodyne; Anthelmintic; Antiinflammatory; Carminative

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

209 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


123 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

82 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99325

Ingredient ID: NPC97716

Ingredient ID: NPC9639

Ingredient ID: NPC94857

Ingredient ID: NPC93761

Ingredient ID: NPC93292

Ingredient ID: NPC91560

Ingredient ID: NPC9117

Ingredient ID: NPC91036

Ingredient ID: NPC8927

Ingredient ID: NPC87971

Ingredient ID: NPC86959

Ingredient ID: NPC86812

Ingredient ID: NPC81697

Ingredient ID: NPC80710

Ingredient ID: NPC80186

Ingredient ID: NPC80002

Ingredient ID: NPC78840

Ingredient ID: NPC78509

Ingredient ID: NPC78192

Ingredient ID: NPC78058

Ingredient ID: NPC78

Ingredient ID: NPC77660

Ingredient ID: NPC77379

Ingredient ID: NPC76336

Ingredient ID: NPC7605

Ingredient ID: NPC73198

Ingredient ID: NPC70854

Ingredient ID: NPC70628

Ingredient ID: NPC69860

Ingredient ID: NPC69541

Ingredient ID: NPC67167

Ingredient ID: NPC67004

Ingredient ID: NPC65540

Ingredient ID: NPC65528

Ingredient ID: NPC63684

Ingredient ID: NPC61457

Ingredient ID: NPC61321

Ingredient ID: NPC59445

Ingredient ID: NPC58342

Ingredient ID: NPC58137

Ingredient ID: NPC57067

Ingredient ID: NPC51725

Ingredient ID: NPC51326

Ingredient ID: NPC50898

Ingredient ID: NPC50742

Ingredient ID: NPC4960

Ingredient ID: NPC49056

Ingredient ID: NPC48624

Ingredient ID: NPC48448

Ingredient ID: NPC475055

Ingredient ID: NPC475054

Ingredient ID: NPC47283

Ingredient ID: NPC45908

Ingredient ID: NPC45141

Ingredient ID: NPC44745

Ingredient ID: NPC42716

Ingredient ID: NPC41770

Ingredient ID: NPC3752

Ingredient ID: NPC37250

Ingredient ID: NPC35038

Ingredient ID: NPC33815

Ingredient ID: NPC33546

Ingredient ID: NPC33258

Ingredient ID: NPC33159

Ingredient ID: NPC31941

Ingredient ID: NPC310538

Ingredient ID: NPC308050

Ingredient ID: NPC306829

Ingredient ID: NPC306686

Ingredient ID: NPC306258

Ingredient ID: NPC301917

Ingredient ID: NPC300798

Ingredient ID: NPC299027

Ingredient ID: NPC294592

Ingredient ID: NPC294409

Ingredient ID: NPC289917

Ingredient ID: NPC288466

Ingredient ID: NPC28683

Ingredient ID: NPC285555

Ingredient ID: NPC283083

Ingredient ID: NPC279495

Ingredient ID: NPC279121

Ingredient ID: NPC278068

Ingredient ID: NPC273306

Ingredient ID: NPC272471

Ingredient ID: NPC272405

Ingredient ID: NPC271803

Ingredient ID: NPC271438

Ingredient ID: NPC268725

Ingredient ID: NPC268580

Ingredient ID: NPC268204

Ingredient ID: NPC267901

Ingredient ID: NPC266383

Ingredient ID: NPC265496

Ingredient ID: NPC265376

Ingredient ID: NPC261245

Ingredient ID: NPC260197

Ingredient ID: NPC25889

Ingredient ID: NPC258494

Ingredient ID: NPC256006

Ingredient ID: NPC254679

Ingredient ID: NPC254238

Ingredient ID: NPC252379

Ingredient ID: NPC250242

Ingredient ID: NPC249606

Ingredient ID: NPC24821

Ingredient ID: NPC247553

Ingredient ID: NPC247455

Ingredient ID: NPC246810

Ingredient ID: NPC246513

Ingredient ID: NPC242893

Ingredient ID: NPC240809

Ingredient ID: NPC238140

Ingredient ID: NPC236657

Ingredient ID: NPC235941

Ingredient ID: NPC235575

Ingredient ID: NPC235217

Ingredient ID: NPC233222

Ingredient ID: NPC231194

Ingredient ID: NPC230302

Ingredient ID: NPC230271

Ingredient ID: NPC229687

Ingredient ID: NPC225660

Ingredient ID: NPC225281

Ingredient ID: NPC224573

Ingredient ID: NPC223812

Ingredient ID: NPC223787

Ingredient ID: NPC221820

Ingredient ID: NPC217372

Ingredient ID: NPC216538

Ingredient ID: NPC215917

Ingredient ID: NPC214125

Ingredient ID: NPC212748

Ingredient ID: NPC212489

Ingredient ID: NPC211309

Ingredient ID: NPC210902

Ingredient ID: NPC210498

Ingredient ID: NPC209560

Ingredient ID: NPC208984

Ingredient ID: NPC208941

Ingredient ID: NPC20791

Ingredient ID: NPC205289

Ingredient ID: NPC203945

Ingredient ID: NPC202236

Ingredient ID: NPC2016

Ingredient ID: NPC200645

Ingredient ID: NPC19898

Ingredient ID: NPC19733

Ingredient ID: NPC196431

Ingredient ID: NPC195763

Ingredient ID: NPC192989

Ingredient ID: NPC18693

Ingredient ID: NPC186928

Ingredient ID: NPC183380

Ingredient ID: NPC180401

Ingredient ID: NPC178632

Ingredient ID: NPC1786

Ingredient ID: NPC178041

Ingredient ID: NPC176846

Ingredient ID: NPC176740

Ingredient ID: NPC176464

Ingredient ID: NPC175229

Ingredient ID: NPC175222

Ingredient ID: NPC171489

Ingredient ID: NPC168017

Ingredient ID: NPC16754

Ingredient ID: NPC164980

Ingredient ID: NPC164907

Ingredient ID: NPC161785

Ingredient ID: NPC161439

Ingredient ID: NPC159560

Ingredient ID: NPC158121

Ingredient ID: NPC157884

Ingredient ID: NPC157265

Ingredient ID: NPC155486

Ingredient ID: NPC155251

Ingredient ID: NPC153979

Ingredient ID: NPC14929

Ingredient ID: NPC147209

Ingredient ID: NPC145707

Ingredient ID: NPC144714

Ingredient ID: NPC143578

Ingredient ID: NPC143344

Ingredient ID: NPC136909

Ingredient ID: NPC135909

Ingredient ID: NPC131579

Ingredient ID: NPC131568

Ingredient ID: NPC131464

Ingredient ID: NPC129654

Ingredient ID: NPC127430

Ingredient ID: NPC127059

Ingredient ID: NPC124359

Ingredient ID: NPC123391

Ingredient ID: NPC122355

Ingredient ID: NPC121813

Ingredient ID: NPC120699

Ingredient ID: NPC116199

Ingredient ID: NPC114368

Ingredient ID: NPC11422

Ingredient ID: NPC111782

Ingredient ID: NPC108418

Ingredient ID: NPC107899

Ingredient ID: NPC10754

Ingredient ID: NPC107177

Ingredient ID: NPC106669

Ingredient ID: NPC10519

Ingredient ID: NPC104593

Ingredient ID: NPC102903